CU147361 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGACTGCGCTTTCTCTCCCTCGGTCTTGGACAAAACGACAGTGTCGTCCGCCCCGTCCACCTTCCTCACCGTCGTTTACTATTTTGCCCTCTCACAGCCTCACGGCCTCTCTCTCATCCAGTCGTTCGATTTCCAATTGCAGCAAGTCCAAACTCCAAAAGATCTTCATTTCTGATATCCCA
BLAST of CU147361 vs. TrEMBL
Match: A0A0A0LI07_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G149440 PE=4 SV=1) HSP 1 Score: 82.4 bits (202), Expect = 2.0e-13 Identity = 39/45 (86.67%), Postives = 39/45 (86.67%), Query Frame = 1
BLAST of CU147361 vs. NCBI nr
Match: gi|700206381|gb|KGN61500.1| (hypothetical protein Csa_2G149440 [Cucumis sativus]) HSP 1 Score: 82.0 bits (201), Expect = 3.8e-13 Identity = 39/45 (86.67%), Postives = 39/45 (86.67%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|