CU149044 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGAAACCCAAGCACACTCACAATTGAAACTACATTTTCCATCTTATTACTTCTCTTGATCTCTACACACCATGGGAGGCAGCCACAGGCAAAAAAAAAACTCATTCTTCCTTCTCCATCTTTAGCTCTTTCAAATCCAAAAGAGGTAGGAAAGGAGATGTTTATGAGCATGGTACCAATTGGGAGATGTGCCAAGC
BLAST of CU149044 vs. TrEMBL
Match: A0A0A0KBW6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G016910 PE=4 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 2.7e-08 Identity = 30/31 (96.77%), Postives = 31/31 (100.00%), Query Frame = -3
BLAST of CU149044 vs. NCBI nr
Match: gi|700190668|gb|KGN45872.1| (hypothetical protein Csa_6G016910 [Cucumis sativus]) HSP 1 Score: 67.0 bits (162), Expect = 1.4e-08 Identity = 30/31 (96.77%), Postives = 31/31 (100.00%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|