CU156771 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGCTGGCTGATGAGTTTGATCTGATTGACCTGCGGTCTCTTAAGAGATAGGCGAAGAGTCTGACGAGCTGAGCAAAGTAGCTATGCGCTGGCGGCTGGAGAAAGCCAACCGAAGATAGCCAATCGAAGATAGCGGGAATGACCGACCGGCTCCGCAAGAAAAGAAGGTTTCGGAACATGTACTGAGAGGCTCCTTGTGCA
BLAST of CU156771 vs. TrEMBL
Match: A0A0A0LI14_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G150520 PE=4 SV=1) HSP 1 Score: 100.5 bits (249), Expect = 8.0e-19 Identity = 49/58 (84.48%), Postives = 51/58 (87.93%), Query Frame = -2
BLAST of CU156771 vs. NCBI nr
Match: gi|700206391|gb|KGN61510.1| (hypothetical protein Csa_2G150520 [Cucumis sativus]) HSP 1 Score: 100.5 bits (249), Expect = 1.1e-18 Identity = 49/58 (84.48%), Postives = 51/58 (87.93%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|