CU157171 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GAAGAACTTCGACTCTTGACCGAAGCTACATTACTATCGCTCGTAGAAATTAGGAGAGCCAGGCCGCTTTAGGCCATAGTGCATTGGGTTTCTTTTGATATTGGAAAATGCGTGGGGAACTCTCGACTTTTGGCTGAAGCCACATTACAATTGCACGTAGAAAGTAGGAGAGACGAGCCGTTTCGGGCCAGAATGAGTCAAGTTCATTTCGTGTCAGAATACTACTTTAAGAACTCT
BLAST of CU157171 vs. TrEMBL
Match: A0A0A0K4I4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G279800 PE=4 SV=1) HSP 1 Score: 90.5 bits (223), Expect = 9.8e-16 Identity = 48/67 (71.64%), Postives = 51/67 (76.12%), Query Frame = 1
BLAST of CU157171 vs. TrEMBL
Match: A0A0A0K4I4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G279800 PE=4 SV=1) HSP 1 Score: 46.6 bits (109), Expect = 1.6e-02 Identity = 35/87 (40.23%), Postives = 35/87 (40.23%), Query Frame = 1
HSP 2 Score: 33.1 bits (74), Expect = 1.8e+02 Identity = 16/19 (84.21%), Postives = 16/19 (84.21%), Query Frame = 3
HSP 3 Score: 73.2 bits (178), Expect = 1.6e-10 Identity = 44/85 (51.76%), Postives = 52/85 (61.18%), Query Frame = -3
BLAST of CU157171 vs. TrEMBL
Match: A0A0A0K4J2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G279850 PE=4 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 5.2e-09 Identity = 41/105 (39.05%), Postives = 50/105 (47.62%), Query Frame = -3
HSP 2 Score: 59.3 bits (142), Expect = 2.4e-06 Identity = 37/79 (46.84%), Postives = 45/79 (56.96%), Query Frame = -3
HSP 3 Score: 51.2 bits (121), Expect = 6.5e-04 Identity = 40/107 (37.38%), Postives = 48/107 (44.86%), Query Frame = -2
HSP 4 Score: 50.4 bits (119), Expect = 1.1e-03 Identity = 38/97 (39.18%), Postives = 44/97 (45.36%), Query Frame = -3
HSP 5 Score: 50.1 bits (118), Expect = 1.5e-03 Identity = 35/74 (47.30%), Postives = 40/74 (54.05%), Query Frame = -2
HSP 6 Score: 44.7 bits (104), Expect = 6.1e-02 Identity = 21/39 (53.85%), Postives = 27/39 (69.23%), Query Frame = -3
HSP 7 Score: 43.5 bits (101), Expect = 1.4e-01 Identity = 18/33 (54.55%), Postives = 24/33 (72.73%), Query Frame = -3
HSP 8 Score: 42.4 bits (98), Expect = 3.0e-01 Identity = 28/62 (45.16%), Postives = 34/62 (54.84%), Query Frame = -2
HSP 9 Score: 41.6 bits (96), Expect = 5.2e-01 Identity = 20/40 (50.00%), Postives = 25/40 (62.50%), Query Frame = -3
HSP 10 Score: 40.8 bits (94), Expect = 8.8e-01 Identity = 22/35 (62.86%), Postives = 26/35 (74.29%), Query Frame = -2
HSP 11 Score: 35.0 bits (79), Expect = 4.8e+01 Identity = 26/56 (46.43%), Postives = 32/56 (57.14%), Query Frame = -2
BLAST of CU157171 vs. NCBI nr
Match: gi|700189165|gb|KGN44398.1| (hypothetical protein Csa_7G279800 [Cucumis sativus]) HSP 1 Score: 92.8 bits (229), Expect = 2.8e-16 Identity = 48/67 (71.64%), Postives = 51/67 (76.12%), Query Frame = 1
BLAST of CU157171 vs. NCBI nr
Match: gi|700189170|gb|KGN44403.1| (hypothetical protein Csa_7G279850 [Cucumis sativus]) HSP 1 Score: 75.9 bits (185), Expect = 3.6e-11 Identity = 44/85 (51.76%), Postives = 52/85 (61.18%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|