CU163460 (transcribed_cluster) Cucumber (Chinese Long) v2 | Cucurbit Genomics Database (CuGenDB)


Name	CU163460
Type	transcribed_cluster
Organism	Cucumis. sativus (Cucumber (Chinese Long) v2)
Description	No hit
Location	Chr7 : 5161900 .. 5161968 (+)
Sequence length	77

The following sequences are available for this feature:

TCAACCGCAAGCTCTGCCGACGGCGGGCGGTTAGTAGTTCCCGGTTTCCTTTTTGTTGGGGTCTTTTTACCCCTAAA


Library category	ESTs
hermaphrodite flower library	1

The following BLAST results are available for this feature:


Match Name	E-value	Identity	Description

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
Csa7G074910	Csa7G074910	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
H0072867	H0072867	EST