CU163298 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGAAGGCGATAACGGTGGTCGGAGACTGTTGTAAATCTTGGTTTGAGAACAGAAACCGCTCCGAGAATCAACAGAATGGGTAGCCATTGATGTGAAATTCAGATTTGTGAAGGAAAATATGAATGAAATTCGTC
BLAST of CU163298 vs. TrEMBL
Match: A0A0A0LWL5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G050300 PE=4 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 1.8e-06 Identity = 27/27 (100.00%), Postives = 27/27 (100.00%), Query Frame = -3
BLAST of CU163298 vs. TrEMBL
Match: A0A0A0LR49_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G050290 PE=4 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 6.7e-06 Identity = 26/27 (96.30%), Postives = 26/27 (96.30%), Query Frame = -3
BLAST of CU163298 vs. TrEMBL
Match: E5GBV5_CUCME (4-coumarate-CoA ligase OS=Cucumis melo subsp. melo PE=4 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 8.8e-06 Identity = 26/27 (96.30%), Postives = 26/27 (96.30%), Query Frame = -3
BLAST of CU163298 vs. TrEMBL
Match: E5GBV5_CUCME (4-coumarate-CoA ligase OS=Cucumis melo subsp. melo PE=4 SV=1) HSP 1 Score: 46.6 bits (109), Expect = 9.1e-03 Identity = 25/45 (55.56%), Postives = 28/45 (62.22%), Query Frame = -3
BLAST of CU163298 vs. NCBI nr
Match: gi|778658041|ref|XP_004152591.2| (PREDICTED: 4-coumarate--CoA ligase-like 9 [Cucumis sativus]) HSP 1 Score: 58.9 bits (141), Expect = 2.5e-06 Identity = 27/27 (100.00%), Postives = 27/27 (100.00%), Query Frame = -3
BLAST of CU163298 vs. NCBI nr
Match: gi|778658045|ref|XP_011652012.1| (PREDICTED: 4-coumarate--CoA ligase-like 9 [Cucumis sativus]) HSP 1 Score: 57.0 bits (136), Expect = 9.6e-06 Identity = 26/27 (96.30%), Postives = 26/27 (96.30%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|