WMU64200 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AAAGCGCAACCCAATAGCTGAAAAGCGAAGCTCCAAGTCCAATTCCCCCACTTCCTGACCGGAGCTGGCTGCAGGCGCAGAGCCAACAATGGGGAGTGCCACTTCGAAGAATCGATTCCTCCTCTTCTTCTGATCCCGATGCTGAAGAATCGCGTATGGCTCGATTCAAGAATCGTGTACATCTTCGTCGCTTTCTTCGTAGGCGTCGTAAAAGCCACCAATGGCCGAGGCTTTCGTTCTCATACCAAACTTGGCTCTGTGGAGGATTTCGCTGGAATCGCTGTTCTAACTCTTATTCGTGCGCGAATGAATTTCAAGGATAAGTGGCTCGCTTGTGTTTCTTTTGGTAGAGCAGACTTTTCGGTACGGGAATCTCTGATCACACTAAAGAACCAGCTTGGAACTCTGAAAAGAAGCTTCTCTTAGGAAAAAGATGGACCTCATATTGCGAGAATCTC
BLAST of WMU64200 vs. TAIR10
Match: AT5G57190.1 (AT5G57190.1 phosphatidylserine decarboxylase 2) HSP 1 Score: 65.1 bits (157), Expect = 4.3e-11 Identity = 35/67 (52.24%), Postives = 41/67 (61.19%), Query Frame = 1
BLAST of WMU64200 vs. TAIR10
Match: AT4G25970.1 (AT4G25970.1 phosphatidylserine decarboxylase 3) HSP 1 Score: 63.9 bits (154), Expect = 9.6e-11 Identity = 36/67 (53.73%), Postives = 41/67 (61.19%), Query Frame = 1
BLAST of WMU64200 vs. Swiss-Prot
Match: PSD2_ARATH (Phosphatidylserine decarboxylase proenzyme 2 OS=Arabidopsis thaliana GN=PSD2 PE=2 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 7.7e-10 Identity = 35/67 (52.24%), Postives = 41/67 (61.19%), Query Frame = 1
BLAST of WMU64200 vs. Swiss-Prot
Match: PSD3_ARATH (Phosphatidylserine decarboxylase proenzyme 3 OS=Arabidopsis thaliana GN=PSD3 PE=1 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 1.7e-09 Identity = 36/67 (53.73%), Postives = 41/67 (61.19%), Query Frame = 1
BLAST of WMU64200 vs. NCBI nr
Match: gi|659110477|ref|XP_008455245.1| (PREDICTED: phosphatidylserine decarboxylase proenzyme 3-like [Cucumis melo]) HSP 1 Score: 109.8 bits (273), Expect = 4.3e-21 Identity = 55/82 (67.07%), Postives = 60/82 (73.17%), Query Frame = 1
BLAST of WMU64200 vs. NCBI nr
Match: gi|778724254|ref|XP_011658767.1| (PREDICTED: phosphatidylserine decarboxylase proenzyme 2 [Cucumis sativus]) HSP 1 Score: 107.5 bits (267), Expect = 2.1e-20 Identity = 54/82 (65.85%), Postives = 59/82 (71.95%), Query Frame = 1
BLAST of WMU64200 vs. NCBI nr
Match: gi|700188445|gb|KGN43678.1| (hypothetical protein Csa_7G058530 [Cucumis sativus]) HSP 1 Score: 107.5 bits (267), Expect = 2.1e-20 Identity = 54/82 (65.85%), Postives = 59/82 (71.95%), Query Frame = 1
BLAST of WMU64200 vs. NCBI nr
Match: gi|976916306|gb|KVI01829.1| (C2 calcium-dependent membrane targeting [Cynara cardunculus var. scolymus]) HSP 1 Score: 79.7 bits (195), Expect = 4.8e-12 Identity = 40/74 (54.05%), Postives = 49/74 (66.22%), Query Frame = 1
BLAST of WMU64200 vs. NCBI nr
Match: gi|645223856|ref|XP_008218832.1| (PREDICTED: phosphatidylserine decarboxylase proenzyme 3-like [Prunus mume]) HSP 1 Score: 78.6 bits (192), Expect = 1.1e-11 Identity = 41/73 (56.16%), Postives = 49/73 (67.12%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|