WMU30009 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CCCAGAGTGGCCTATTTACGGCGGGCGATAGGGATCGTTATATGTCGCCCATAGAGGCTGTAGAATATGGATTGATTGATGGAGTGATCGACAAAGATGGCATTATACCTCTCATGCCAGTGCCCCGAAAGAGTGAAGGCAAGTTTAAATTATGAAGAAATTAGTAAAGATCCCAGAAAATTCTTGACACCAGATGTCCCTGACGACGAGATATATTAGTTTCAGGCGTTTTCGGCAAAACCCTTCTCTAGGGTTTGATTTATTTCACATGTAGGATCTTAGAGTATCAACTTTTGGCAAACTGTCTCTACTTACCAGAAGTTAAAAGGTATTGGGTATTGGACTTCTTTTTTTTGTCTGAAATTTTTAAATGAGCATTCTGAGGAAGAAAATTGACAATGAATCATATTTTGTATT
BLAST of WMU30009 vs. TAIR10
Match: AT5G45390.1 (AT5G45390.1 CLP protease P4) HSP 1 Score: 63.5 bits (153), Expect = 1.1e-10 Identity = 30/33 (90.91%), Postives = 28/33 (84.85%), Query Frame = 3
HSP 2 Score: 57.4 bits (137), Expect = 8.2e-09 Identity = 24/31 (77.42%), Postives = 26/31 (83.87%), Query Frame = 1
BLAST of WMU30009 vs. Swiss-Prot
Match: CLPP4_ARATH (ATP-dependent Clp protease proteolytic subunit 4, chloroplastic OS=Arabidopsis thaliana GN=CLPP4 PE=1 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 2.0e-09 Identity = 30/33 (90.91%), Postives = 28/33 (84.85%), Query Frame = 3
HSP 2 Score: 57.4 bits (137), Expect = 1.5e-07 Identity = 24/31 (77.42%), Postives = 26/31 (83.87%), Query Frame = 1
BLAST of WMU30009 vs. TrEMBL
Match: A0A0A0L3S1_CUCSA (ATP-dependent Clp protease proteolytic subunit OS=Cucumis sativus GN=Csa_3G005040 PE=3 SV=1) HSP 1 Score: 73.2 bits (178), Expect = 2.8e-10 Identity = 34/40 (85.00%), Postives = 36/40 (90.00%), Query Frame = 3
BLAST of WMU30009 vs. TrEMBL
Match: A0A0A0L3S1_CUCSA (ATP-dependent Clp protease proteolytic subunit OS=Cucumis sativus GN=Csa_3G005040 PE=3 SV=1) HSP 1 Score: 52.4 bits (124), Expect = 5.2e-04 Identity = 21/31 (67.74%), Postives = 25/31 (80.65%), Query Frame = 1
HSP 2 Score: 67.8 bits (164), Expect = 1.2e-08 Identity = 33/40 (82.50%), Postives = 33/40 (82.50%), Query Frame = 3
BLAST of WMU30009 vs. TrEMBL
Match: A0A0K9RS56_SPIOL (ATP-dependent Clp protease proteolytic subunit OS=Spinacia oleracea GN=SOVF_035430 PE=3 SV=1) HSP 1 Score: 52.8 bits (125), Expect = 4.0e-04 Identity = 21/31 (67.74%), Postives = 28/31 (90.32%), Query Frame = 1
HSP 2 Score: 67.8 bits (164), Expect = 1.2e-08 Identity = 30/35 (85.71%), Postives = 33/35 (94.29%), Query Frame = 3
BLAST of WMU30009 vs. TrEMBL
Match: A0A059CBQ6_EUCGR (ATP-dependent Clp protease proteolytic subunit OS=Eucalyptus grandis GN=EUGRSUZ_D00191 PE=3 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 7.8e-08 Identity = 28/31 (90.32%), Postives = 31/31 (100.00%), Query Frame = 1
HSP 2 Score: 67.8 bits (164), Expect = 1.2e-08 Identity = 31/40 (77.50%), Postives = 35/40 (87.50%), Query Frame = 3
BLAST of WMU30009 vs. TrEMBL
Match: A0A067E648_CITSI (ATP-dependent Clp protease proteolytic subunit OS=Citrus sinensis GN=CISIN_1g041849mg PE=3 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 8.9e-04 Identity = 22/30 (73.33%), Postives = 25/30 (83.33%), Query Frame = 1
HSP 2 Score: 67.8 bits (164), Expect = 1.2e-08 Identity = 32/40 (80.00%), Postives = 34/40 (85.00%), Query Frame = 3
BLAST of WMU30009 vs. NCBI nr
Match: gi|449456777|ref|XP_004146125.1| (PREDICTED: ATP-dependent Clp protease proteolytic subunit 4, chloroplastic [Cucumis sativus]) HSP 1 Score: 76.3 bits (186), Expect = 4.8e-11 Identity = 34/40 (85.00%), Postives = 36/40 (90.00%), Query Frame = 3
BLAST of WMU30009 vs. NCBI nr
Match: gi|1009107988|ref|XP_015882512.1| (PREDICTED: ATP-dependent Clp protease proteolytic subunit 4, chloroplastic [Ziziphus jujuba]) HSP 1 Score: 72.8 bits (177), Expect = 5.3e-10 Identity = 31/39 (79.49%), Postives = 36/39 (92.31%), Query Frame = 3
BLAST of WMU30009 vs. NCBI nr
Match: gi|672160444|ref|XP_008800005.1| (PREDICTED: ATP-dependent Clp protease proteolytic subunit 4, chloroplastic [Phoenix dactylifera]) HSP 1 Score: 72.4 bits (176), Expect = 7.0e-10 Identity = 32/39 (82.05%), Postives = 35/39 (89.74%), Query Frame = 3
BLAST of WMU30009 vs. NCBI nr
Match: gi|719999561|ref|XP_010255757.1| (PREDICTED: ATP-dependent Clp protease proteolytic subunit 4, chloroplastic-like [Nelumbo nucifera]) HSP 1 Score: 71.6 bits (174), Expect = 1.2e-09 Identity = 31/39 (79.49%), Postives = 35/39 (89.74%), Query Frame = 3
BLAST of WMU30009 vs. NCBI nr
Match: gi|720073760|ref|XP_010278809.1| (PREDICTED: ATP-dependent Clp protease proteolytic subunit 4, chloroplastic-like [Nelumbo nucifera]) HSP 1 Score: 71.6 bits (174), Expect = 1.2e-09 Identity = 30/39 (76.92%), Postives = 36/39 (92.31%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|