CmoCh06G004670.1 (mRNA) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAGAGGCTAAATTCGGATCTGTACTTGCAGAACTGTTACATAATGAAGGAAAATGAAAGACTGAGGAAGAAAGCACAGATATTGAACCAAGAAAATCAAGCTCTTCTTTCAGAACTGAAGCAGAAATTGTCGAAAGGGAAAACGAAATCGATCCCTGATCTTAATGTATGCTCTGCTTCGCTTACAAATCCTTCTAATTCTTCACGTTGA ATGGAGAGGCTAAATTCGGATCTGTACTTGCAGAACTGTTACATAATGAAGGAAAATGAAAGACTGAGGAAGAAAGCACAGATATTGAACCAAGAAAATCAAGCTCTTCTTTCAGAACTGAAGCAGAAATTGTCGAAAGGGAAAACGAAATCGATCCCTGATCTTAATGTATGCTCTGCTTCGCTTACAAATCCTTCTAATTCTTCACGTTGA ATGGAGAGGCTAAATTCGGATCTGTACTTGCAGAACTGTTACATAATGAAGGAAAATGAAAGACTGAGGAAGAAAGCACAGATATTGAACCAAGAAAATCAAGCTCTTCTTTCAGAACTGAAGCAGAAATTGTCGAAAGGGAAAACGAAATCGATCCCTGATCTTAATGTATGCTCTGCTTCGCTTACAAATCCTTCTAATTCTTCACGTTGA
BLAST of CmoCh06G004670.1 vs. Swiss-Prot
Match: ZPR4_ARATH (Protein LITTLE ZIPPER 4 OS=Arabidopsis thaliana GN=ZPR4 PE=1 SV=1) HSP 1 Score: 81.6 bits (200), Expect = 3.6e-15 Identity = 44/51 (86.27%), Postives = 45/51 (88.24%), Query Frame = 1
BLAST of CmoCh06G004670.1 vs. Swiss-Prot
Match: ZPR3_ARATH (Protein LITTLE ZIPPER 3 OS=Arabidopsis thaliana GN=ZPR3 PE=1 SV=1) HSP 1 Score: 75.1 bits (183), Expect = 3.4e-13 Identity = 38/51 (74.51%), Postives = 45/51 (88.24%), Query Frame = 1
BLAST of CmoCh06G004670.1 vs. TrEMBL
Match: V4S7L4_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10013416mg PE=4 SV=1) HSP 1 Score: 109.8 bits (273), Expect = 1.4e-21 Identity = 59/73 (80.82%), Postives = 66/73 (90.41%), Query Frame = 1
BLAST of CmoCh06G004670.1 vs. TrEMBL
Match: A0A067F196_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g047813mg PE=4 SV=1) HSP 1 Score: 109.8 bits (273), Expect = 1.4e-21 Identity = 59/73 (80.82%), Postives = 66/73 (90.41%), Query Frame = 1
BLAST of CmoCh06G004670.1 vs. TrEMBL
Match: A0A0A0LE03_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G776310 PE=4 SV=1) HSP 1 Score: 103.6 bits (257), Expect = 1.0e-19 Identity = 60/74 (81.08%), Postives = 64/74 (86.49%), Query Frame = 1
BLAST of CmoCh06G004670.1 vs. TrEMBL
Match: A0A0D2QAN8_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_006G156000 PE=4 SV=1) HSP 1 Score: 102.1 bits (253), Expect = 2.9e-19 Identity = 58/78 (74.36%), Postives = 62/78 (79.49%), Query Frame = 1
BLAST of CmoCh06G004670.1 vs. TrEMBL
Match: A0A067L2W9_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_23672 PE=4 SV=1) HSP 1 Score: 101.7 bits (252), Expect = 3.8e-19 Identity = 57/75 (76.00%), Postives = 63/75 (84.00%), Query Frame = 1
BLAST of CmoCh06G004670.1 vs. TAIR10
Match: AT3G52770.1 (AT3G52770.1 protein binding) HSP 1 Score: 75.1 bits (183), Expect = 1.9e-14 Identity = 38/51 (74.51%), Postives = 45/51 (88.24%), Query Frame = 1
BLAST of CmoCh06G004670.1 vs. NCBI nr
Match: gi|567875287|ref|XP_006430233.1| (hypothetical protein CICLE_v10013416mg [Citrus clementina]) HSP 1 Score: 109.8 bits (273), Expect = 2.0e-21 Identity = 59/73 (80.82%), Postives = 66/73 (90.41%), Query Frame = 1
BLAST of CmoCh06G004670.1 vs. NCBI nr
Match: gi|568856447|ref|XP_006481795.1| (PREDICTED: protein LITTLE ZIPPER 4-like [Citrus sinensis]) HSP 1 Score: 109.0 bits (271), Expect = 3.4e-21 Identity = 59/75 (78.67%), Postives = 66/75 (88.00%), Query Frame = 1
BLAST of CmoCh06G004670.1 vs. NCBI nr
Match: gi|659084321|ref|XP_008442826.1| (PREDICTED: uncharacterized protein LOC103486597 [Cucumis melo]) HSP 1 Score: 103.6 bits (257), Expect = 1.4e-19 Identity = 60/74 (81.08%), Postives = 64/74 (86.49%), Query Frame = 1
BLAST of CmoCh06G004670.1 vs. NCBI nr
Match: gi|763769163|gb|KJB36378.1| (hypothetical protein B456_006G156000 [Gossypium raimondii]) HSP 1 Score: 102.1 bits (253), Expect = 4.2e-19 Identity = 58/78 (74.36%), Postives = 62/78 (79.49%), Query Frame = 1
BLAST of CmoCh06G004670.1 vs. NCBI nr
Match: gi|643736413|gb|KDP42732.1| (hypothetical protein JCGZ_23672 [Jatropha curcas]) HSP 1 Score: 101.7 bits (252), Expect = 5.4e-19 Identity = 57/75 (76.00%), Postives = 63/75 (84.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this mRNA:
GO Assignments
This mRNA is annotated with the following GO terms.
This mRNA is a part of the following gene feature(s):
The following polypeptide feature(s) derives from this mRNA:
The following exon feature(s) are a part of this mRNA:
The following CDS feature(s) are a part of this mRNA:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
|