CmoCh14G007640 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCGGACCCAGCCATTTACGACTTCCTTACCCAAACAACAACCGCTTCAAATTCTGCACCAAAAGCTTCCAGAAAGTTCCAGTCTCAATACTCTTCCTCTCGCATTTTTCCATGCCTTTACTGCCCTCGCAAATTTTACACTTCTCAAGCCCTAGGCGGCCACCAAAACGCTCACAAGAGAGAAAGAGCCGCCTCTCGTAAGGCTTTCGCCTCTGAAATTCTTCATCTCGGTTCGCTTCCGCCGCCGCCGCCGCCGACGACGACGACGACTCACCACCATCTTCCGCAGCCTTACACGGTTGCTCCATCTCCGACTCCGACTCCGACTCCGGCTCCGGCTGATTTTCTCGGCCAGCATTGGTTTAATCAGAATCACTACAGTGCTAACACCACCACCACTGCCTCCGCCTCCGCCTCCGCCTCGCCGGATGCTCTCTCTCCGAACGCCGATACCGCCGTTGAACATGTAACCATCGATCTCACTCTTCGCTTATAA ATGGCGGACCCAGCCATTTACGACTTCCTTACCCAAACAACAACCGCTTCAAATTCTGCACCAAAAGCTTCCAGAAAGTTCCAGTCTCAATACTCTTCCTCTCGCATTTTTCCATGCCTTTACTGCCCTCGCAAATTTTACACTTCTCAAGCCCTAGGCGGCCACCAAAACGCTCACAAGAGAGAAAGAGCCGCCTCTCGTAAGGCTTTCGCCTCTGAAATTCTTCATCTCGGTTCGCTTCCGCCGCCGCCGCCGCCGACGACGACGACGACTCACCACCATCTTCCGCAGCCTTACACGGTTGCTCCATCTCCGACTCCGACTCCGACTCCGGCTCCGGCTGATTTTCTCGGCCAGCATTGGTTTAATCAGAATCACTACAGTGCTAACACCACCACCACTGCCTCCGCCTCCGCCTCCGCCTCGCCGGATGCTCTCTCTCCGAACGCCGATACCGCCGTTGAACATGTAACCATCGATCTCACTCTTCGCTTATAA ATGGCGGACCCAGCCATTTACGACTTCCTTACCCAAACAACAACCGCTTCAAATTCTGCACCAAAAGCTTCCAGAAAGTTCCAGTCTCAATACTCTTCCTCTCGCATTTTTCCATGCCTTTACTGCCCTCGCAAATTTTACACTTCTCAAGCCCTAGGCGGCCACCAAAACGCTCACAAGAGAGAAAGAGCCGCCTCTCGTAAGGCTTTCGCCTCTGAAATTCTTCATCTCGGTTCGCTTCCGCCGCCGCCGCCGCCGACGACGACGACGACTCACCACCATCTTCCGCAGCCTTACACGGTTGCTCCATCTCCGACTCCGACTCCGACTCCGGCTCCGGCTGATTTTCTCGGCCAGCATTGGTTTAATCAGAATCACTACAGTGCTAACACCACCACCACTGCCTCCGCCTCCGCCTCCGCCTCGCCGGATGCTCTCTCTCCGAACGCCGATACCGCCGTTGAACATGTAACCATCGATCTCACTCTTCGCTTATAA
BLAST of CmoCh14G007640 vs. Swiss-Prot
Match: KNU_ARATH (Zinc finger protein KNUCKLES OS=Arabidopsis thaliana GN=KNU PE=1 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 1.2e-11 Identity = 42/82 (51.22%), Postives = 52/82 (63.41%), Query Frame = 1
BLAST of CmoCh14G007640 vs. Swiss-Prot
Match: ZFP7_ARATH (Zinc finger protein 7 OS=Arabidopsis thaliana GN=ZFP7 PE=2 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 1.1e-09 Identity = 33/69 (47.83%), Postives = 43/69 (62.32%), Query Frame = 1
BLAST of CmoCh14G007640 vs. Swiss-Prot
Match: LATE_ARATH (Protein LATE FLOWERING OS=Arabidopsis thaliana GN=LATE PE=2 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 3.2e-09 Identity = 44/98 (44.90%), Postives = 57/98 (58.16%), Query Frame = 1
BLAST of CmoCh14G007640 vs. Swiss-Prot
Match: ZFP4_ARATH (Zinc finger protein 4 OS=Arabidopsis thaliana GN=ZFP4 PE=2 SV=2) HSP 1 Score: 62.8 bits (151), Expect = 4.1e-09 Identity = 31/60 (51.67%), Postives = 43/60 (71.67%), Query Frame = 1
BLAST of CmoCh14G007640 vs. Swiss-Prot
Match: ZFP1_ARATH (Zinc finger protein 1 OS=Arabidopsis thaliana GN=ZFP1 PE=2 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 1.2e-08 Identity = 33/72 (45.83%), Postives = 45/72 (62.50%), Query Frame = 1
BLAST of CmoCh14G007640 vs. TrEMBL
Match: A0A0A0LDF1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G509430 PE=4 SV=1) HSP 1 Score: 158.3 bits (399), Expect = 8.0e-36 Identity = 105/182 (57.69%), Postives = 118/182 (64.84%), Query Frame = 1
BLAST of CmoCh14G007640 vs. TrEMBL
Match: A0A061ED83_THECC (Uncharacterized protein OS=Theobroma cacao GN=TCM_017291 PE=4 SV=1) HSP 1 Score: 93.2 bits (230), Expect = 3.2e-16 Identity = 73/171 (42.69%), Postives = 93/171 (54.39%), Query Frame = 1
BLAST of CmoCh14G007640 vs. TrEMBL
Match: A0A0D2V3S8_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_012G083200 PE=4 SV=1) HSP 1 Score: 87.4 bits (215), Expect = 1.7e-14 Identity = 70/176 (39.77%), Postives = 92/176 (52.27%), Query Frame = 1
BLAST of CmoCh14G007640 vs. TrEMBL
Match: B9RH19_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_1446140 PE=4 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 2.3e-14 Identity = 71/196 (36.22%), Postives = 92/196 (46.94%), Query Frame = 1
BLAST of CmoCh14G007640 vs. TrEMBL
Match: B9GFF8_POPTR (Zinc finger family protein OS=Populus trichocarpa GN=POPTR_0001s33210g PE=4 SV=1) HSP 1 Score: 84.3 bits (207), Expect = 1.5e-13 Identity = 57/130 (43.85%), Postives = 76/130 (58.46%), Query Frame = 1
BLAST of CmoCh14G007640 vs. TAIR10
Match: AT5G14010.1 (AT5G14010.1 C2H2 and C2HC zinc fingers superfamily protein) HSP 1 Score: 71.2 bits (173), Expect = 6.5e-13 Identity = 42/82 (51.22%), Postives = 52/82 (63.41%), Query Frame = 1
BLAST of CmoCh14G007640 vs. TAIR10
Match: AT1G24625.1 (AT1G24625.1 zinc finger protein 7) HSP 1 Score: 64.7 bits (156), Expect = 6.1e-11 Identity = 33/69 (47.83%), Postives = 43/69 (62.32%), Query Frame = 1
BLAST of CmoCh14G007640 vs. TAIR10
Match: AT5G48890.1 (AT5G48890.1 C2H2-like zinc finger protein) HSP 1 Score: 63.2 bits (152), Expect = 1.8e-10 Identity = 44/98 (44.90%), Postives = 57/98 (58.16%), Query Frame = 1
BLAST of CmoCh14G007640 vs. TAIR10
Match: AT1G66140.1 (AT1G66140.1 zinc finger protein 4) HSP 1 Score: 62.8 bits (151), Expect = 2.3e-10 Identity = 31/60 (51.67%), Postives = 43/60 (71.67%), Query Frame = 1
BLAST of CmoCh14G007640 vs. TAIR10
Match: AT1G80730.1 (AT1G80730.1 zinc-finger protein 1) HSP 1 Score: 61.2 bits (147), Expect = 6.8e-10 Identity = 33/72 (45.83%), Postives = 45/72 (62.50%), Query Frame = 1
BLAST of CmoCh14G007640 vs. NCBI nr
Match: gi|659098600|ref|XP_008450219.1| (PREDICTED: zinc finger protein KNUCKLES [Cucumis melo]) HSP 1 Score: 167.5 bits (423), Expect = 1.9e-38 Identity = 109/184 (59.24%), Postives = 122/184 (66.30%), Query Frame = 1
BLAST of CmoCh14G007640 vs. NCBI nr
Match: gi|700202963|gb|KGN58096.1| (hypothetical protein Csa_3G509430 [Cucumis sativus]) HSP 1 Score: 158.3 bits (399), Expect = 1.2e-35 Identity = 105/182 (57.69%), Postives = 118/182 (64.84%), Query Frame = 1
BLAST of CmoCh14G007640 vs. NCBI nr
Match: gi|731418691|ref|XP_010660770.1| (PREDICTED: zinc finger protein 2 [Vitis vinifera]) HSP 1 Score: 106.3 bits (264), Expect = 5.2e-20 Identity = 70/168 (41.67%), Postives = 94/168 (55.95%), Query Frame = 1
BLAST of CmoCh14G007640 vs. NCBI nr
Match: gi|590647673|ref|XP_007031965.1| (Uncharacterized protein TCM_017291 [Theobroma cacao]) HSP 1 Score: 93.2 bits (230), Expect = 4.6e-16 Identity = 73/171 (42.69%), Postives = 93/171 (54.39%), Query Frame = 1
BLAST of CmoCh14G007640 vs. NCBI nr
Match: gi|1009152155|ref|XP_015893941.1| (PREDICTED: zinc finger protein KNUCKLES [Ziziphus jujuba]) HSP 1 Score: 89.4 bits (220), Expect = 6.6e-15 Identity = 72/179 (40.22%), Postives = 94/179 (52.51%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|