WMU77992 (transcribed_cluster) Watermelon (97103) v1 | Cucurbit Genomics Database (CuGenDB)

Overview


Name	WMU77992
Type	transcribed_cluster
Organism	Citrullus. lanatus (Watermelon (97103) v1)
Description	No hit
Location	Chr3 : 13661113 .. 13666054 (+)
Sequence length	311

Genome Viewer

Sequences

The following sequences are available for this feature:

transcribed_cluster sequence

GGGTTCCCCTTCCATATTCTTTCTTGACTCAATCTCGTCTCTCTCACAACATCTAGGGCACGCCCTGCTTGAGATCTCTCCTTCCCCTTCCATCTTCTTCATTTTCCCCAATCTCTCTCTCTCTCAGCTTCATCGCTTCAAAAATCGGCTCAATCTGACGGCTCCTTGATTCTGTACATCTATTTCCATCGTTAGAAGATGGCAACAAAATACATAGTAGCTTCTTTATTTGGTGCAACTGCAGTTGTATATATCTTTGACCATCTTATTGCTGACAAGAAATATTTGAAGTTAGAAGATGGCAGCAAAAT

Library


Library category	ESTs
watermelon fruit 34d library	1

Homology

The following BLAST results are available for this feature:

BLAST of WMU77992 vs. NCBI nr


Match Name	E-value	Identity	Description

Annotated Terms

The following terms have been associated with this transcribed_cluster:

Vocabulary: **INTERPRO**
Term	Definition
IPR009515	DUF1138

Relationships

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
Cla002670	Cla002670	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
S4_0159861	S4_0159861	EST

InterPro

Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16


IPR Term	IPR Description	Source	Source Term	Source Description	Alignment
IPR009515	Protein of unknown function DUF1138	PFAM	PF06592	DUF1138	coord: 3..30 score: 1.