WMU76587 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TATTCATATCAAAAGGTTGATTCAGAAACAAGAAGCAAAAAGCAAAAAAGAAAGAGAAAAATGTCTGTTGTGACAGAGGAAATCAAAAGGCAAAGCAGATGAAGTACACCATGGAGATGAGATGTGCCAAGAGAAATCCAAAAGAATTACTGAAAGAAATAGGGCTTCCAAATGGGCTTTTGCCATTGAAAGACATAGAAGAATGTGGGATTGTAAG
BLAST of WMU76587 vs. TAIR10
Match: AT1G56580.1 (AT1G56580.1 Protein of unknown function, DUF538) HSP 1 Score: 47.8 bits (112), Expect = 3.3e-06 Identity = 23/41 (56.10%), Postives = 28/41 (68.29%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|