|
|
The following sequences are available for this feature:
transcribed_cluster sequence AGCCAATTTCAGCAGATTCGGCCCTTCTTCGCATAATCGCCGCGCCACCGGTCGGCATCTCGAATATTTGCTCCTTGGGGGACGTCCCACTGTTATGACATAGAATTCC
The following BLAST results are available for this feature:
| Match Name | E-value | Identity | Description | |
|---|
The following terms have been associated with this transcribed_cluster:
Vocabulary: INTERPRO
| Term | Definition |
|---|
| IPR003685 | PsaD |
Vocabulary: Cellular Component
| Term | Definition |
|---|
| GO:0009522 | photosystem I |
| GO:0009538 | photosystem I reaction center |
Vocabulary: Biological Process
| Term | Definition |
|---|
| GO:0015979 | photosynthesis |
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
| Category |
Term Accession |
Term Name |
| biological_process |
GO:0015979 |
photosynthesis |
| cellular_component |
GO:0009522 |
photosystem I |
| cellular_component |
GO:0009538 |
photosystem I reaction center |
This transcribed_cluster is associated with the following gene feature(s):
| Feature Name | Unique Name | Type |
|---|
| Cla021635 | Cla021635 | gene |
The following EST feature(s) are a part of this transcribed_cluster:
| Feature Name | Unique Name | Type |
|---|
| S3_0173662 | S3_0173662 | EST |
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
| IPR Term | IPR Description | Source | Source Term | Source Description | Alignment |
|---|
| IPR003685 | Photosystem I PsaD | GENE3D | G3DSA:3.30.1470.10 | | coord: 9..28
score: 1. |
| IPR003685 | Photosystem I PsaD | PFAM | PF02531 | PsaD | coord: 9..28
score: 2. |
| IPR003685 | Photosystem I PsaD | unknown | SSF64234 | Photosystem I subunit PsaD | coord: 9..28
score: 2.4 |
|
