|
The following sequences are available for this feature:
transcribed_cluster sequence GTATCAATTTTATAGGGGTTTTTCCTAATGGGGAAGTTCAATATTTGCATCCTAAAAGATGGGGTTTATCCAGAGAAGGTGAATCCAGGAAGGGAAGGAGTTGGTCAGAAATTTCAGGTCTATTGGG
The following BLAST results are available for this feature:
Match Name | E-value | Identity | Description | |
The following terms have been associated with this transcribed_cluster:
Vocabulary: INTERPRO
Term | Definition |
IPR003685 | PsaD |
Vocabulary: Cellular Component
Term | Definition |
GO:0009522 | photosystem I |
GO:0009538 | photosystem I reaction center |
Vocabulary: Biological Process
Term | Definition |
GO:0015979 | photosynthesis |
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
Category |
Term Accession |
Term Name |
biological_process |
GO:0015979 |
photosynthesis |
cellular_component |
GO:0009522 |
photosystem I |
cellular_component |
GO:0009538 |
photosystem I reaction center |
This transcribed_cluster is associated with the following gene feature(s):
Feature Name | Unique Name | Type |
Cla021635 | Cla021635 | gene |
The following EST feature(s) are a part of this transcribed_cluster:
Feature Name | Unique Name | Type |
S3_0090328 | S3_0090328 | EST |
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
IPR Term | IPR Description | Source | Source Term | Source Description | Alignment |
IPR003685 | Photosystem I PsaD | GENE3D | G3DSA:3.30.1470.10 | | coord: 2..29 score: 1. |
IPR003685 | Photosystem I PsaD | unknown | SSF64234 | Photosystem I subunit PsaD | coord: 3..29 score: 8. |
|