WMU70586 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CTCTCACTGTCACCTTCATCCAATCCTTACCTCTCATTCTCCACTCCGGCCATCCGATACCGATTCGCAACCAAAATGTCGGAAAATAATCCTCCTCCTCCACCGTCTCAGCCGGCGGATCCGGACGCTCCGCTTAAGGCAGTCGGATTCAAGCTGGATCACGAATCTGCTCAGAGAGTGAGCGGCCGCATCGTCGTTTCCCCAATCTGCTGCCAGCCGTTTAATGTGTTGCACGGAGGAGTATCGGCGTTGATTGCAGAGGCTTTGGCGAGCAAGGGGGCTTATGTGGCGTCGGGTTACCGGAAAGTTGTCGGAATCCATCTCAGTATCAATCACTTGAGGAGCGCTGAGATGGGCGCCGTCGTTCTCGCCGAAGCTACTCCAGTCACCGTCGCAGAACCATTCAGGTATGGGATGTACAATTATGGAAAT
BLAST of WMU70586 vs. TAIR10
Match: AT1G48320.1 (AT1G48320.1 Thioesterase superfamily protein) HSP 1 Score: 118.6 bits (296), Expect = 3.1e-27 Identity = 55/89 (61.80%), Postives = 71/89 (79.78%), Query Frame = 1
BLAST of WMU70586 vs. TAIR10
Match: AT5G48950.1 (AT5G48950.1 Thioesterase superfamily protein) HSP 1 Score: 112.1 bits (279), Expect = 2.9e-25 Identity = 55/89 (61.80%), Postives = 67/89 (75.28%), Query Frame = 1
BLAST of WMU70586 vs. Swiss-Prot
Match: DNAT1_ARATH (1,4-dihydroxy-2-naphthoyl-CoA thioesterase 1 OS=Arabidopsis thaliana GN=DHNAT1 PE=1 SV=1) HSP 1 Score: 118.6 bits (296), Expect = 5.5e-26 Identity = 55/89 (61.80%), Postives = 71/89 (79.78%), Query Frame = 1
BLAST of WMU70586 vs. Swiss-Prot
Match: DNAT2_ARATH (1,4-dihydroxy-2-naphthoyl-CoA thioesterase 2 OS=Arabidopsis thaliana GN=DHNAT2 PE=2 SV=1) HSP 1 Score: 112.1 bits (279), Expect = 5.2e-24 Identity = 55/89 (61.80%), Postives = 67/89 (75.28%), Query Frame = 1
BLAST of WMU70586 vs. Swiss-Prot
Match: MENI_ECOLI (1,4-dihydroxy-2-naphthoyl-CoA hydrolase OS=Escherichia coli (strain K12) GN=menI PE=1 SV=1) HSP 1 Score: 53.5 bits (127), Expect = 2.2e-06 Identity = 29/78 (37.18%), Postives = 43/78 (55.13%), Query Frame = 1
BLAST of WMU70586 vs. NCBI nr
Match: gi|449459808|ref|XP_004147638.1| (PREDICTED: 1,4-dihydroxy-2-naphthoyl-CoA thioesterase 1-like [Cucumis sativus]) HSP 1 Score: 127.9 bits (320), Expect = 1.5e-26 Identity = 60/87 (68.97%), Postives = 76/87 (87.36%), Query Frame = 1
BLAST of WMU70586 vs. NCBI nr
Match: gi|629095417|gb|KCW61412.1| (hypothetical protein EUGRSUZ_H04139 [Eucalyptus grandis]) HSP 1 Score: 124.8 bits (312), Expect = 1.2e-25 Identity = 61/96 (63.54%), Postives = 80/96 (83.33%), Query Frame = 1
BLAST of WMU70586 vs. NCBI nr
Match: gi|702447387|ref|XP_010024888.1| (PREDICTED: uncharacterized protein LOC104415310 [Eucalyptus grandis]) HSP 1 Score: 120.9 bits (302), Expect = 1.8e-24 Identity = 60/89 (67.42%), Postives = 76/89 (85.39%), Query Frame = 1
BLAST of WMU70586 vs. NCBI nr
Match: gi|567134190|ref|XP_006393434.1| (hypothetical protein EUTSA_v10011840mg [Eutrema salsugineum]) HSP 1 Score: 120.6 bits (301), Expect = 2.3e-24 Identity = 57/89 (64.04%), Postives = 75/89 (84.27%), Query Frame = 1
BLAST of WMU70586 vs. NCBI nr
Match: gi|1009163640|ref|XP_015900072.1| (PREDICTED: 1,4-dihydroxy-2-naphthoyl-CoA thioesterase 1 isoform X1 [Ziziphus jujuba]) HSP 1 Score: 120.6 bits (301), Expect = 2.3e-24 Identity = 57/89 (64.04%), Postives = 76/89 (85.39%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|