WMU68636 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AGAGTGGTCCTATTTACGGTCCGGGAGGTGTTAGCAAAAGCATGTGAGAATCCAACCTGTGCTGAGATTGGGGATTGCTGCAGTCATCTCAAACTGCCCTTTGCTATTGAGATTGATAAAAGCATATCCTCGTGATTTCATGCAAAAGAGGGAGAGTGCGGATCCAGCTGAAGAAGGAGGACGGAAC
BLAST of WMU68636 vs. TAIR10
Match: AT1G48160.1 (AT1G48160.1 signal recognition particle 19 kDa protein, putative / SRP19, putative) HSP 1 Score: 54.7 bits (130), Expect = 2.4e-08 Identity = 21/31 (67.74%), Postives = 24/31 (77.42%), Query Frame = 1
BLAST of WMU68636 vs. Swiss-Prot
Match: SRP19_ARATH (Signal recognition particle 19 kDa protein OS=Arabidopsis thaliana GN=SRP19 PE=1 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 4.2e-07 Identity = 21/31 (67.74%), Postives = 24/31 (77.42%), Query Frame = 1
BLAST of WMU68636 vs. Swiss-Prot
Match: SRP19_ORYSJ (Signal recognition particle 19 kDa protein OS=Oryza sativa subsp. japonica GN=SRP19 PE=1 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 7.2e-07 Identity = 21/29 (72.41%), Postives = 23/29 (79.31%), Query Frame = 1
BLAST of WMU68636 vs. NCBI nr
Match: gi|1009137619|ref|XP_015886153.1| (PREDICTED: signal recognition particle 19 kDa protein [Ziziphus jujuba]) HSP 1 Score: 68.6 bits (166), Expect = 4.5e-09 Identity = 29/34 (85.29%), Postives = 31/34 (91.18%), Query Frame = 1
BLAST of WMU68636 vs. NCBI nr
Match: gi|950930855|ref|XP_014505520.1| (PREDICTED: signal recognition particle 19 kDa protein-like [Vigna radiata var. radiata]) HSP 1 Score: 68.2 bits (165), Expect = 5.9e-09 Identity = 29/34 (85.29%), Postives = 32/34 (94.12%), Query Frame = 1
BLAST of WMU68636 vs. NCBI nr
Match: gi|449459788|ref|XP_004147628.1| (PREDICTED: signal recognition particle 19 kDa protein [Cucumis sativus]) HSP 1 Score: 68.2 bits (165), Expect = 5.9e-09 Identity = 28/31 (90.32%), Postives = 31/31 (100.00%), Query Frame = 1
BLAST of WMU68636 vs. NCBI nr
Match: gi|920715770|gb|KOM55858.1| (hypothetical protein LR48_Vigan10g175000 [Vigna angularis]) HSP 1 Score: 68.2 bits (165), Expect = 5.9e-09 Identity = 29/34 (85.29%), Postives = 32/34 (94.12%), Query Frame = 1
BLAST of WMU68636 vs. NCBI nr
Match: gi|1012354091|gb|KYP65278.1| (Signal recognition particle 19 kDa protein [Cajanus cajan]) HSP 1 Score: 68.2 bits (165), Expect = 5.9e-09 Identity = 29/31 (93.55%), Postives = 31/31 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|