WMU68587 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GTTTCAATGGCTAATGCAGGCCCAAAACACAAATGGGTCTCAGTTTTTTATCACAACCGTAGCCACTCCTTGGCTGGACAACAAGCATACAGTGTTTGGACGAGTTATTAAAAGGCATGGACGTTGTGCAGACAATCGAGAAAGTGAAAACCAGACAAGGCAGACAAGC
BLAST of WMU68587 vs. TAIR10
Match: AT3G44600.1 (AT3G44600.1 cyclophilin71) HSP 1 Score: 64.7 bits (156), Expect = 2.1e-11 Identity = 28/29 (96.55%), Postives = 27/29 (93.10%), Query Frame = 2
BLAST of WMU68587 vs. TAIR10
Match: AT3G62030.2 (AT3G62030.2 rotamase CYP 4) HSP 1 Score: 52.8 bits (125), Expect = 8.2e-08 Identity = 23/29 (79.31%), Postives = 23/29 (79.31%), Query Frame = 2
BLAST of WMU68587 vs. TAIR10
Match: AT5G58710.1 (AT5G58710.1 rotamase CYP 7) HSP 1 Score: 51.6 bits (122), Expect = 1.8e-07 Identity = 21/29 (72.41%), Postives = 23/29 (79.31%), Query Frame = 2
BLAST of WMU68587 vs. TAIR10
Match: AT2G29960.1 (AT2G29960.1 cyclophilin 5) HSP 1 Score: 50.8 bits (120), Expect = 3.1e-07 Identity = 20/30 (66.67%), Postives = 24/30 (80.00%), Query Frame = 2
BLAST of WMU68587 vs. TAIR10
Match: AT2G21130.1 (AT2G21130.1 Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein) HSP 1 Score: 50.1 bits (118), Expect = 5.3e-07 Identity = 21/29 (72.41%), Postives = 22/29 (75.86%), Query Frame = 2
BLAST of WMU68587 vs. Swiss-Prot
Match: CPY71_ARATH (Peptidyl-prolyl cis-trans isomerase CYP71 OS=Arabidopsis thaliana GN=CYP71 PE=1 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 3.7e-10 Identity = 28/29 (96.55%), Postives = 27/29 (93.10%), Query Frame = 2
BLAST of WMU68587 vs. Swiss-Prot
Match: PPWD1_PONAB (Peptidylprolyl isomerase domain and WD repeat-containing protein 1 OS=Pongo abelii GN=PPWD1 PE=2 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 1.5e-08 Identity = 26/29 (89.66%), Postives = 24/29 (82.76%), Query Frame = 2
BLAST of WMU68587 vs. Swiss-Prot
Match: PPWD1_MOUSE (Peptidylprolyl isomerase domain and WD repeat-containing protein 1 OS=Mus musculus GN=Ppwd1 PE=1 SV=2) HSP 1 Score: 59.3 bits (142), Expect = 1.5e-08 Identity = 26/29 (89.66%), Postives = 24/29 (82.76%), Query Frame = 2
BLAST of WMU68587 vs. Swiss-Prot
Match: PPWD1_BOVIN (Peptidylprolyl isomerase domain and WD repeat-containing protein 1 OS=Bos taurus GN=PPWD1 PE=2 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 1.5e-08 Identity = 26/29 (89.66%), Postives = 24/29 (82.76%), Query Frame = 2
BLAST of WMU68587 vs. Swiss-Prot
Match: PPWD1_HUMAN (Peptidylprolyl isomerase domain and WD repeat-containing protein 1 OS=Homo sapiens GN=PPWD1 PE=1 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 1.5e-08 Identity = 26/29 (89.66%), Postives = 24/29 (82.76%), Query Frame = 2
BLAST of WMU68587 vs. NCBI nr
Match: gi|764560000|ref|XP_011461124.1| (PREDICTED: peptidyl-prolyl cis-trans isomerase CYP71 [Fragaria vesca subsp. vesca]) HSP 1 Score: 67.4 bits (163), Expect = 9.1e-09 Identity = 30/30 (100.00%), Postives = 30/30 (100.00%), Query Frame = 2
BLAST of WMU68587 vs. NCBI nr
Match: gi|922431517|ref|XP_013621854.1| (PREDICTED: peptidyl-prolyl cis-trans isomerase CYP71 [Brassica oleracea var. oleracea]) HSP 1 Score: 67.0 bits (162), Expect = 1.2e-08 Identity = 29/30 (96.67%), Postives = 30/30 (100.00%), Query Frame = 2
BLAST of WMU68587 vs. NCBI nr
Match: gi|567159824|ref|XP_006419120.1| (hypothetical protein EUTSA_v10002440mg [Eutrema salsugineum]) HSP 1 Score: 67.0 bits (162), Expect = 1.2e-08 Identity = 29/30 (96.67%), Postives = 30/30 (100.00%), Query Frame = 2
BLAST of WMU68587 vs. NCBI nr
Match: gi|1002866388|ref|XP_015696024.1| (PREDICTED: peptidyl-prolyl cis-trans isomerase CYP71 [Oryza brachyantha]) HSP 1 Score: 67.0 bits (162), Expect = 1.2e-08 Identity = 29/30 (96.67%), Postives = 30/30 (100.00%), Query Frame = 2
BLAST of WMU68587 vs. NCBI nr
Match: gi|674934344|emb|CDX99192.1| (BnaA06g18830D [Brassica napus]) HSP 1 Score: 67.0 bits (162), Expect = 1.2e-08 Identity = 29/30 (96.67%), Postives = 30/30 (100.00%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|