WMU67527 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CCCGTCCTCCCCGCCACTCTCTCCGGCTAAAATGGAAGAAAAATGAGGCACATACGGTGGCGGTGGGTAGTCCGTGTGCGGCTTGTAAAATTCTCCGGCGAAGATGCCGAGAGAATTGCGAATTGGGGCCGTATTTTCCTCCAACGGAACCTCTCAAATTCACTATTGCTCATAGGGTCTTCGGTGCTAGCAACATCATCAAATTGCTTCAGGTAATTTCTCTTTGTTTGGTAACGGTTTTGTTTCTAGCTGATTACTGGATATAAACCTTTCCTTTAGATTCAATTAAA
BLAST of WMU67527 vs. TAIR10
Match: AT1G07900.1 (AT1G07900.1 LOB domain-containing protein 1) HSP 1 Score: 91.3 bits (225), Expect = 3.6e-19 Identity = 41/48 (85.42%), Postives = 40/48 (83.33%), Query Frame = 3
BLAST of WMU67527 vs. TAIR10
Match: AT2G28500.1 (AT2G28500.1 LOB domain-containing protein 11) HSP 1 Score: 90.1 bits (222), Expect = 7.9e-19 Identity = 40/48 (83.33%), Postives = 40/48 (83.33%), Query Frame = 3
BLAST of WMU67527 vs. TAIR10
Match: AT1G31320.1 (AT1G31320.1 LOB domain-containing protein 4) HSP 1 Score: 76.6 bits (187), Expect = 9.1e-15 Identity = 33/62 (53.23%), Postives = 39/62 (62.90%), Query Frame = 3
BLAST of WMU67527 vs. TAIR10
Match: AT2G30130.1 (AT2G30130.1 Lateral organ boundaries (LOB) domain family protein) HSP 1 Score: 76.6 bits (187), Expect = 9.1e-15 Identity = 31/48 (64.58%), Postives = 37/48 (77.08%), Query Frame = 3
BLAST of WMU67527 vs. TAIR10
Match: AT2G23660.1 (AT2G23660.1 LOB domain-containing protein 10) HSP 1 Score: 75.5 bits (184), Expect = 2.0e-14 Identity = 30/47 (63.83%), Postives = 34/47 (72.34%), Query Frame = 3
BLAST of WMU67527 vs. Swiss-Prot
Match: LBD1_ARATH (LOB domain-containing protein 1 OS=Arabidopsis thaliana GN=LBD1 PE=2 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 6.3e-18 Identity = 41/48 (85.42%), Postives = 40/48 (83.33%), Query Frame = 3
BLAST of WMU67527 vs. Swiss-Prot
Match: LBD11_ARATH (LOB domain-containing protein 11 OS=Arabidopsis thaliana GN=LBD11 PE=2 SV=2) HSP 1 Score: 90.1 bits (222), Expect = 1.4e-17 Identity = 40/48 (83.33%), Postives = 40/48 (83.33%), Query Frame = 3
BLAST of WMU67527 vs. Swiss-Prot
Match: LBD12_ARATH (LOB domain-containing protein 12 OS=Arabidopsis thaliana GN=LBD12 PE=2 SV=2) HSP 1 Score: 76.6 bits (187), Expect = 1.6e-13 Identity = 31/48 (64.58%), Postives = 37/48 (77.08%), Query Frame = 3
BLAST of WMU67527 vs. Swiss-Prot
Match: LBD4_ARATH (LOB domain-containing protein 4 OS=Arabidopsis thaliana GN=LBD4 PE=2 SV=1) HSP 1 Score: 76.6 bits (187), Expect = 1.6e-13 Identity = 33/62 (53.23%), Postives = 39/62 (62.90%), Query Frame = 3
BLAST of WMU67527 vs. Swiss-Prot
Match: LBD6_ORYSJ (LOB domain-containing protein 6 OS=Oryza sativa subsp. japonica GN=LBD6 PE=2 SV=1) HSP 1 Score: 76.3 bits (186), Expect = 2.1e-13 Identity = 35/56 (62.50%), Postives = 38/56 (67.86%), Query Frame = 3
BLAST of WMU67527 vs. NCBI nr
Match: gi|659072136|ref|XP_008463578.1| (PREDICTED: LOB domain-containing protein 1-like [Cucumis melo]) HSP 1 Score: 106.7 bits (265), Expect = 2.3e-20 Identity = 53/65 (81.54%), Postives = 55/65 (84.62%), Query Frame = 3
BLAST of WMU67527 vs. NCBI nr
Match: gi|449459128|ref|XP_004147298.1| (PREDICTED: LOB domain-containing protein 1-like [Cucumis sativus]) HSP 1 Score: 103.6 bits (257), Expect = 2.0e-19 Identity = 48/55 (87.27%), Postives = 48/55 (87.27%), Query Frame = 3
BLAST of WMU67527 vs. NCBI nr
Match: gi|695047706|ref|XP_009411741.1| (PREDICTED: LOB domain-containing protein 1-like [Musa acuminata subsp. malaccensis]) HSP 1 Score: 101.3 bits (251), Expect = 9.7e-19 Identity = 45/53 (84.91%), Postives = 47/53 (88.68%), Query Frame = 3
BLAST of WMU67527 vs. NCBI nr
Match: gi|1021039579|gb|KZM97360.1| (hypothetical protein DCAR_015278 [Daucus carota subsp. sativus]) HSP 1 Score: 100.1 bits (248), Expect = 2.2e-18 Identity = 46/53 (86.79%), Postives = 47/53 (88.68%), Query Frame = 3
BLAST of WMU67527 vs. NCBI nr
Match: gi|604335663|gb|EYU39551.1| (hypothetical protein MIMGU_mgv1a019423mg [Erythranthe guttata]) HSP 1 Score: 99.4 bits (246), Expect = 3.7e-18 Identity = 47/55 (85.45%), Postives = 49/55 (89.09%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|