WMU65835 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TAAAAGAAAAGAAACAACTTACCCTTACTACCCTGTTTCTCTCTGTTCTTCTTTTGAAAGACCAGCCATGGCTTTAAGATGGCTGGCTTCATTCAACAAGTTATCTTCTTGGGAACCCAACTGAGGTCCATGGCTATGGTGAAGAGAGAAGTTCAAAAGTTAAAAAGGGTTATGAAGAAATATGCACTTCTGGGTTTCAAATGCCTCTTCATTACCCTCGCTACAACAAGGCAGATTACCAGAAGATGGAGGAGTGGAAGCTTGATCTCCTTCTCAAGGAATATGGCTTGAGTTTTCAAGGCAGTTTTGGAGGAGAAGAGGGCTTTTGCAATGGGTGCTTTTCTATGGCCTGATCAGTATTGATGCTCTTTTATCTCTCTCTCTTTCAAATAAGATTACTGTCTTCTGCTCTGTCATCTTCATTTTTAGGGAGAGTTGTATCCGTGCAGCTCAGCCTGTACTTGGACGAACTCATGGTGTTGGTAC
BLAST of WMU65835 vs. TAIR10
Match: AT3G09950.1 (AT3G09950.1 unknown protein) HSP 1 Score: 63.9 bits (154), Expect = 1.0e-10 Identity = 27/41 (65.85%), Postives = 31/41 (75.61%), Query Frame = 3
BLAST of WMU65835 vs. TAIR10
Match: AT5G41761.1 (AT5G41761.1 unknown protein) HSP 1 Score: 58.9 bits (141), Expect = 3.3e-09 Identity = 24/47 (51.06%), Postives = 33/47 (70.21%), Query Frame = 3
BLAST of WMU65835 vs. TAIR10
Match: AT5G55620.1 (AT5G55620.1 unknown protein) HSP 1 Score: 56.2 bits (134), Expect = 2.1e-08 Identity = 24/46 (52.17%), Postives = 34/46 (73.91%), Query Frame = 3
HSP 2 Score: 33.5 bits (75), Expect = 1.5e-01 Identity = 13/21 (61.90%), Postives = 15/21 (71.43%), Query Frame = 1
BLAST of WMU65835 vs. TAIR10
Match: AT3G55570.1 (AT3G55570.1 unknown protein) HSP 1 Score: 53.1 bits (126), Expect = 1.8e-07 Identity = 22/32 (68.75%), Postives = 24/32 (75.00%), Query Frame = 3
BLAST of WMU65835 vs. NCBI nr
Match: gi|778720128|ref|XP_011658113.1| (PREDICTED: uncharacterized protein LOC105435946 [Cucumis sativus]) HSP 1 Score: 129.4 bits (324), Expect = 5.6e-27 Identity = 58/68 (85.29%), Postives = 60/68 (88.24%), Query Frame = 3
BLAST of WMU65835 vs. NCBI nr
Match: gi|590627017|ref|XP_007026334.1| (Uncharacterized protein TCM_030413 [Theobroma cacao]) HSP 1 Score: 76.3 bits (186), Expect = 5.6e-11 Identity = 42/91 (46.15%), Postives = 52/91 (57.14%), Query Frame = 3
BLAST of WMU65835 vs. NCBI nr
Match: gi|567915199|ref|XP_006449913.1| (hypothetical protein CICLE_v10017538mg, partial [Citrus clementina]) HSP 1 Score: 75.1 bits (183), Expect = 1.3e-10 Identity = 34/57 (59.65%), Postives = 41/57 (71.93%), Query Frame = 3
BLAST of WMU65835 vs. NCBI nr
Match: gi|698443507|ref|XP_009764626.1| (PREDICTED: uncharacterized protein LOC104216298 [Nicotiana sylvestris]) HSP 1 Score: 74.3 bits (181), Expect = 2.1e-10 Identity = 35/74 (47.30%), Postives = 47/74 (63.51%), Query Frame = 3
BLAST of WMU65835 vs. NCBI nr
Match: gi|641859833|gb|KDO78523.1| (hypothetical protein CISIN_1g045350mg [Citrus sinensis]) HSP 1 Score: 73.9 bits (180), Expect = 2.8e-10 Identity = 34/57 (59.65%), Postives = 41/57 (71.93%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|