WMU64524 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AGACCCTTACACACTCTTTGTATTAGAAATGGCTCTAATGGGCTTTGCTGAACACAGAAGATTTCAAGATTGGTCCAAGCCAGGGTCCATGGGAAAACAATACTTTTTGGGCCTAGAGAAGTTCTTGGGTGGGTCAGGGGACCCAGCTTACCCAGGTGGGCCCTTGTTCAACCCATTAGGGTTTTGGGAAAGATGAGAAGTCATTGAAGGATTTGAAGCTGAAGGAAGTGAAGAATGGAAGGCTTGCAATGTTGGCAATATTGGGTTATTTTGTACAAGGTCTTGTCACTGGTGTTGGGCCTTACCAAAACCTTTTGGATCATTTGTCTGACCCAGTCAACAACAATGTTTTGACCAGCCTTAAAATTCCACTAGAAGAAGGGATATTATGTGAATTGTAATTTGTGCATTGTATATTAATATGGGTCACAGTCCCTTTTGGGTT
BLAST of WMU64524 vs. TAIR10
Match: AT1G61520.1 (AT1G61520.1 photosystem I light harvesting complex gene 3) HSP 1 Score: 115.5 bits (288), Expect = 2.7e-26 Identity = 53/61 (86.89%), Postives = 52/61 (85.25%), Query Frame = 2
BLAST of WMU64524 vs. TAIR10
Match: AT1G29920.1 (AT1G29920.1 chlorophyll A/B-binding protein 2) HSP 1 Score: 61.6 bits (148), Expect = 4.6e-10 Identity = 26/38 (68.42%), Postives = 30/38 (78.95%), Query Frame = 3
BLAST of WMU64524 vs. TAIR10
Match: AT1G29930.1 (AT1G29930.1 chlorophyll A/B binding protein 1) HSP 1 Score: 61.6 bits (148), Expect = 4.6e-10 Identity = 26/38 (68.42%), Postives = 30/38 (78.95%), Query Frame = 3
BLAST of WMU64524 vs. TAIR10
Match: AT2G34420.1 (AT2G34420.1 photosystem II light harvesting complex gene B1B2) HSP 1 Score: 61.6 bits (148), Expect = 4.6e-10 Identity = 26/38 (68.42%), Postives = 30/38 (78.95%), Query Frame = 3
BLAST of WMU64524 vs. TAIR10
Match: AT2G34430.1 (AT2G34430.1 light-harvesting chlorophyll-protein complex II subunit B1) HSP 1 Score: 61.6 bits (148), Expect = 4.6e-10 Identity = 26/38 (68.42%), Postives = 30/38 (78.95%), Query Frame = 3
BLAST of WMU64524 vs. Swiss-Prot
Match: CB13_SOLLC (Chlorophyll a-b binding protein 8, chloroplastic OS=Solanum lycopersicum GN=CAB8 PE=3 SV=1) HSP 1 Score: 126.7 bits (317), Expect = 2.1e-28 Identity = 58/61 (95.08%), Postives = 57/61 (93.44%), Query Frame = 2
BLAST of WMU64524 vs. Swiss-Prot
Match: CB23_PEA (Chlorophyll a-b binding protein 3, chloroplastic OS=Pisum sativum GN=lhca3 PE=1 SV=1) HSP 1 Score: 121.7 bits (304), Expect = 6.7e-27 Identity = 55/61 (90.16%), Postives = 55/61 (90.16%), Query Frame = 2
BLAST of WMU64524 vs. Swiss-Prot
Match: LHCA3_ARATH (Photosystem I chlorophyll a/b-binding protein 3-1, chloroplastic OS=Arabidopsis thaliana GN=LHCA3 PE=1 SV=1) HSP 1 Score: 115.5 bits (288), Expect = 4.8e-25 Identity = 53/61 (86.89%), Postives = 52/61 (85.25%), Query Frame = 2
BLAST of WMU64524 vs. Swiss-Prot
Match: CB28_PEA (Chlorophyll a-b binding protein 8, chloroplastic OS=Pisum sativum GN=CAB8 PE=1 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 3.7e-09 Identity = 27/38 (71.05%), Postives = 30/38 (78.95%), Query Frame = 3
BLAST of WMU64524 vs. Swiss-Prot
Match: CB25_NICPL (Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia GN=CABE PE=3 SV=1) HSP 1 Score: 62.4 bits (150), Expect = 4.8e-09 Identity = 27/38 (71.05%), Postives = 30/38 (78.95%), Query Frame = 3
BLAST of WMU64524 vs. NCBI nr
Match: gi|659098797|ref|XP_008450298.1| (PREDICTED: chlorophyll a-b binding protein 8, chloroplastic [Cucumis melo]) HSP 1 Score: 135.6 bits (340), Expect = 7.2e-29 Identity = 60/61 (98.36%), Postives = 61/61 (100.00%), Query Frame = 2
BLAST of WMU64524 vs. NCBI nr
Match: gi|255567170|ref|XP_002524566.1| (PREDICTED: chlorophyll a-b binding protein 8, chloroplastic [Ricinus communis]) HSP 1 Score: 134.0 bits (336), Expect = 2.1e-28 Identity = 59/61 (96.72%), Postives = 60/61 (98.36%), Query Frame = 2
BLAST of WMU64524 vs. NCBI nr
Match: gi|449442612|ref|XP_004139075.1| (PREDICTED: chlorophyll a-b binding protein 8, chloroplastic [Cucumis sativus]) HSP 1 Score: 134.0 bits (336), Expect = 2.1e-28 Identity = 59/61 (96.72%), Postives = 60/61 (98.36%), Query Frame = 2
BLAST of WMU64524 vs. NCBI nr
Match: gi|116519121|gb|ABJ99590.1| (type III chlorophyll a/b-binding protein [Lycoris aurea]) HSP 1 Score: 133.3 bits (334), Expect = 3.6e-28 Identity = 58/61 (95.08%), Postives = 60/61 (98.36%), Query Frame = 2
BLAST of WMU64524 vs. NCBI nr
Match: gi|116519125|gb|ABJ99591.1| (type III chlorophyll a/b-binding protein [Lycoris aurea]) HSP 1 Score: 133.3 bits (334), Expect = 3.6e-28 Identity = 58/61 (95.08%), Postives = 60/61 (98.36%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|