WMU59382 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GAGAGGAGAGATGGTTGGAAAGAGAGGGACCTAAATCGTCTAGGATGTCTGCGATTACTACTTTGGCTCCATGCTTAAAGAAGTGTCTTGCAATGGACTCCCCAATTCCTCTGGCTGCACCTGTTGATTATTAAGACCACTTTGCCTTCTAGTCTTCTCGCAGCGGCTGGAAGCAAGGGGACGCCCCATGGCT
BLAST of WMU59382 vs. TAIR10
Match: AT1G52340.1 (AT1G52340.1 NAD(P)-binding Rossmann-fold superfamily protein) HSP 1 Score: 48.5 bits (114), Expect = 1.8e-06 Identity = 24/39 (61.54%), Postives = 24/39 (61.54%), Query Frame = -1
BLAST of WMU59382 vs. NCBI nr
Match: gi|449443650|ref|XP_004139590.1| (PREDICTED: secoisolariciresinol dehydrogenase [Cucumis sativus]) HSP 1 Score: 74.3 bits (181), Expect = 8.5e-11 Identity = 36/41 (87.80%), Postives = 37/41 (90.24%), Query Frame = -1
BLAST of WMU59382 vs. NCBI nr
Match: gi|743796904|ref|XP_011006659.1| (PREDICTED: momilactone A synthase-like [Populus euphratica]) HSP 1 Score: 61.2 bits (147), Expect = 7.4e-07 Identity = 29/41 (70.73%), Postives = 32/41 (78.05%), Query Frame = -1
BLAST of WMU59382 vs. NCBI nr
Match: gi|566167707|ref|XP_006384780.1| (alcohol dehydroge family protein [Populus trichocarpa]) HSP 1 Score: 61.2 bits (147), Expect = 7.4e-07 Identity = 29/41 (70.73%), Postives = 32/41 (78.05%), Query Frame = -1
BLAST of WMU59382 vs. NCBI nr
Match: gi|976915470|gb|KVI01412.1| (Glucose/ribitol dehydrogenase [Cynara cardunculus var. scolymus]) HSP 1 Score: 60.8 bits (146), Expect = 9.7e-07 Identity = 28/35 (80.00%), Postives = 31/35 (88.57%), Query Frame = -1
BLAST of WMU59382 vs. NCBI nr
Match: gi|731344741|ref|XP_010683578.1| (PREDICTED: short-chain dehydrogenase reductase 2a-like [Beta vulgaris subsp. vulgaris]) HSP 1 Score: 60.5 bits (145), Expect = 1.3e-06 Identity = 29/40 (72.50%), Postives = 33/40 (82.50%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|