WMU59215 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
ACTCGCCGTACTTGATTCCGACTTTGTTAGGGTTAACGGCGGTGAAAATCATCCGAATGTTGAGGGAAAGAGAGGCAGTGGTGGGATTGGGATTGGTTATGCCCATATACTGGACGCCGACCTGCTGGAGATCGAACTTGGGGTTTTTGGTTTGTAGAGCGAGTACGACGACGAGGACGACAGCGAGGATTAAGAGGCGAGAAAGGAGAAGAGGAGGAAGAGCAGCAGCAGCAGTCCTTTGAAGGAGGCGGAGGAGGAGGATCTGGGGTTGGTAGCGAGGGTGGAGGCCG
BLAST of WMU59215 vs. TAIR10
Match: AT2G01080.1 (AT2G01080.1 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family) HSP 1 Score: 80.5 bits (197), Expect = 6.3e-16 Identity = 40/53 (75.47%), Postives = 43/53 (81.13%), Query Frame = -2
BLAST of WMU59215 vs. NCBI nr
Match: gi|659092735|ref|XP_008447191.1| (PREDICTED: uncharacterized protein LOC103489700 isoform X2 [Cucumis melo]) HSP 1 Score: 95.9 bits (237), Expect = 4.1e-17 Identity = 46/49 (93.88%), Postives = 47/49 (95.92%), Query Frame = -2
BLAST of WMU59215 vs. NCBI nr
Match: gi|659092733|ref|XP_008447190.1| (PREDICTED: uncharacterized protein LOC103489700 isoform X1 [Cucumis melo]) HSP 1 Score: 95.9 bits (237), Expect = 4.1e-17 Identity = 46/49 (93.88%), Postives = 47/49 (95.92%), Query Frame = -2
BLAST of WMU59215 vs. NCBI nr
Match: gi|449444084|ref|XP_004139805.1| (PREDICTED: uncharacterized protein LOC101207234 [Cucumis sativus]) HSP 1 Score: 91.3 bits (225), Expect = 1.0e-15 Identity = 44/49 (89.80%), Postives = 46/49 (93.88%), Query Frame = -2
BLAST of WMU59215 vs. NCBI nr
Match: gi|703127528|ref|XP_010103853.1| (hypothetical protein L484_024155 [Morus notabilis]) HSP 1 Score: 85.1 bits (209), Expect = 7.2e-14 Identity = 45/64 (70.31%), Postives = 47/64 (73.44%), Query Frame = -2
BLAST of WMU59215 vs. NCBI nr
Match: gi|470131281|ref|XP_004301525.1| (PREDICTED: uncharacterized protein LOC101293795 [Fragaria vesca subsp. vesca]) HSP 1 Score: 85.1 bits (209), Expect = 7.2e-14 Identity = 42/53 (79.25%), Postives = 46/53 (86.79%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|