WMU58592 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CTTTGGAGTGTTTGTAGGCAGCCATAGGCCGGAGTTACAAGCACCTTGTTGTTGTCAAGTTTAAGGAGGGTGTGAATGTGGATGAAATTGTGGAGCAAGTGGAGAAGATGGTTTCTGATATTGACTCTGTCAAGTTCCTTTGAGTGAAGATAAGGTGTTTTCTAAGGGTGGAATTGTCAGACCTGGTGGTGTATTTCTCCTTTCTTTGCTT
BLAST of WMU58592 vs. NCBI nr
Match: gi|659071770|ref|XP_008461858.1| (PREDICTED: uncharacterized protein At5g22580-like [Cucumis melo]) HSP 1 Score: 65.1 bits (157), Expect = 5.6e-08 Identity = 32/34 (94.12%), Postives = 33/34 (97.06%), Query Frame = 3
BLAST of WMU58592 vs. NCBI nr
Match: gi|449443414|ref|XP_004139472.1| (PREDICTED: uncharacterized protein At5g22580-like [Cucumis sativus]) HSP 1 Score: 59.3 bits (142), Expect = 3.0e-06 Identity = 29/33 (87.88%), Postives = 31/33 (93.94%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|