WMU57527 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CCGAGCAACACTTGATCTATGACCAAAATAACTTCACCAAGTCCACCGAAGCACCTCCAGTTTTACTTACTGGAACATGCTCGAATCCTCGGCGGCCCTTCTTGCTCATTCTGCCTTCTCTTGCTGAAGCGACATTCTGCACTGCTATCTCATAGAGCTGTTCTCTAATCGCAAAAGCAATTGCAGGTCCAACTTCAGGGTCTTCAATACCCAAATCTTTGCATAATGTCCTGGAGAACTCTTCAGGGTCACTCTCATAGTTGTTCAAGTCCCACAGAAACTGATCCTTTATAAGCGTATTGTTCACTCGGAGATCAAGCTTGATTGGAATAATCTTTTCACCAGTATACATATCTTGACCTTCAA
BLAST of WMU57527 vs. TAIR10
Match: AT3G17590.2 (AT3G17590.2 transcription regulatory protein SNF5, putative (BSH)) HSP 1 Score: 197.6 bits (501), Expect = 4.4e-51 Identity = 94/113 (83.19%), Postives = 103/113 (91.15%), Query Frame = -3
HSP 2 Score: 35.4 bits (80), Expect = 2.9e-02 Identity = 20/64 (31.25%), Postives = 35/64 (54.69%), Query Frame = -3
BLAST of WMU57527 vs. Swiss-Prot
Match: BSH_ARATH (Chromatin structure-remodeling complex protein BSH OS=Arabidopsis thaliana GN=BSH PE=1 SV=2) HSP 1 Score: 197.6 bits (501), Expect = 7.9e-50 Identity = 94/113 (83.19%), Postives = 103/113 (91.15%), Query Frame = -3
HSP 2 Score: 36.2 bits (82), Expect = 3.0e-01 Identity = 21/66 (31.82%), Postives = 36/66 (54.55%), Query Frame = -3
BLAST of WMU57527 vs. Swiss-Prot
Match: SFH1_YEAST (Chromatin structure-remodeling complex subunit SFH1 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=SFH1 PE=1 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 4.8e-07 Identity = 32/75 (42.67%), Postives = 43/75 (57.33%), Query Frame = -3
BLAST of WMU57527 vs. Swiss-Prot
Match: SNF5_YEAST (SWI/SNF chromatin-remodeling complex subunit SNF5 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=SNF5 PE=1 SV=3) HSP 1 Score: 53.1 bits (126), Expect = 2.4e-06 Identity = 29/70 (41.43%), Postives = 44/70 (62.86%), Query Frame = -3
BLAST of WMU57527 vs. Swiss-Prot
Match: SNF5_TETFL (SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1 OS=Tetraodon fluviatilis GN=smarcb1 PE=3 SV=1) HSP 1 Score: 52.4 bits (124), Expect = 4.1e-06 Identity = 23/62 (37.10%), Postives = 34/62 (54.84%), Query Frame = -3
BLAST of WMU57527 vs. NCBI nr
Match: gi|449459804|ref|XP_004147636.1| (PREDICTED: chromatin structure-remodeling complex protein BSH isoform X1 [Cucumis sativus]) HSP 1 Score: 224.6 bits (571), Expect = 9.6e-56 Identity = 110/113 (97.35%), Postives = 111/113 (98.23%), Query Frame = -3
BLAST of WMU57527 vs. NCBI nr
Match: gi|778679191|ref|XP_011651102.1| (PREDICTED: chromatin structure-remodeling complex protein BSH isoform X3 [Cucumis sativus]) HSP 1 Score: 224.6 bits (571), Expect = 9.6e-56 Identity = 110/113 (97.35%), Postives = 111/113 (98.23%), Query Frame = -3
BLAST of WMU57527 vs. NCBI nr
Match: gi|659077056|ref|XP_008439008.1| (PREDICTED: chromatin structure-remodeling complex protein BSH isoform X1 [Cucumis melo]) HSP 1 Score: 223.8 bits (569), Expect = 1.6e-55 Identity = 109/113 (96.46%), Postives = 111/113 (98.23%), Query Frame = -3
BLAST of WMU57527 vs. NCBI nr
Match: gi|778679188|ref|XP_011651101.1| (PREDICTED: chromatin structure-remodeling complex protein BSH isoform X2 [Cucumis sativus]) HSP 1 Score: 222.6 bits (566), Expect = 3.6e-55 Identity = 109/112 (97.32%), Postives = 110/112 (98.21%), Query Frame = -3
BLAST of WMU57527 vs. NCBI nr
Match: gi|659077059|ref|XP_008439009.1| (PREDICTED: chromatin structure-remodeling complex protein BSH isoform X2 [Cucumis melo]) HSP 1 Score: 221.9 bits (564), Expect = 6.2e-55 Identity = 108/112 (96.43%), Postives = 110/112 (98.21%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|