WMU57289 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TGGGTCCTCAAAGAGTTCTCTAAGTAAAAGTCAAGATGAAGCAGGTCGTTGGTATATGTCCAGAAAGGAAATTGAAGAAAATTCCCCATCAAGAAGAGATGGTATTGACTTGAAGAAGGAGACTTATTTACGGAAGTCATACTGCACATTTTTGCAAGATCTGGGGCATGAGGCTCAAAGTGCCTCAAGTAACGATAGCCACAGCAATAATATTCTGTCATCGATTCTT
BLAST of WMU57289 vs. TAIR10
Match: AT5G45190.2 (AT5G45190.2 Cyclin family protein) HSP 1 Score: 85.9 bits (211), Expect = 1.2e-17 Identity = 39/45 (86.67%), Postives = 38/45 (84.44%), Query Frame = 2
HSP 2 Score: 32.3 bits (72), Expect = 1.5e-01 Identity = 19/37 (51.35%), Postives = 19/37 (51.35%), Query Frame = 3
BLAST of WMU57289 vs. TAIR10
Match: AT4G19600.1 (AT4G19600.1 Cyclin family protein) HSP 1 Score: 85.1 bits (209), Expect = 2.0e-17 Identity = 39/45 (86.67%), Postives = 37/45 (82.22%), Query Frame = 2
HSP 2 Score: 47.0 bits (110), Expect = 6.0e-06 Identity = 22/26 (84.62%), Postives = 21/26 (80.77%), Query Frame = 3
BLAST of WMU57289 vs. TAIR10
Match: AT1G27630.1 (AT1G27630.1 cyclin T 1;3) HSP 1 Score: 68.2 bits (165), Expect = 2.5e-12 Identity = 31/45 (68.89%), Postives = 34/45 (75.56%), Query Frame = 2
BLAST of WMU57289 vs. TAIR10
Match: AT4G19560.1 (AT4G19560.1 Cyclin family protein) HSP 1 Score: 67.4 bits (163), Expect = 4.3e-12 Identity = 32/44 (72.73%), Postives = 33/44 (75.00%), Query Frame = 2
HSP 2 Score: 45.4 bits (106), Expect = 1.7e-05 Identity = 21/26 (80.77%), Postives = 20/26 (76.92%), Query Frame = 3
BLAST of WMU57289 vs. TAIR10
Match: AT1G35440.1 (AT1G35440.1 cyclin T1;1) HSP 1 Score: 55.1 bits (131), Expect = 2.2e-08 Identity = 25/43 (58.14%), Postives = 31/43 (72.09%), Query Frame = 2
HSP 2 Score: 32.3 bits (72), Expect = 1.5e-01 Identity = 15/26 (57.69%), Postives = 15/26 (57.69%), Query Frame = 3
BLAST of WMU57289 vs. Swiss-Prot
Match: CCT15_ARATH (Cyclin-T1-5 OS=Arabidopsis thaliana GN=CYCT1-5 PE=1 SV=2) HSP 1 Score: 85.9 bits (211), Expect = 2.1e-16 Identity = 39/45 (86.67%), Postives = 38/45 (84.44%), Query Frame = 2
HSP 2 Score: 47.0 bits (110), Expect = 1.1e-04 Identity = 22/26 (84.62%), Postives = 21/26 (80.77%), Query Frame = 3
BLAST of WMU57289 vs. Swiss-Prot
Match: CCT14_ARATH (Cyclin-T1-4 OS=Arabidopsis thaliana GN=CYCT1-4 PE=1 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 3.6e-16 Identity = 39/45 (86.67%), Postives = 37/45 (82.22%), Query Frame = 2
HSP 2 Score: 47.0 bits (110), Expect = 1.1e-04 Identity = 22/26 (84.62%), Postives = 21/26 (80.77%), Query Frame = 3
BLAST of WMU57289 vs. Swiss-Prot
Match: CCT14_ORYSJ (Cyclin-T1-4 OS=Oryza sativa subsp. japonica GN=CYCT1-1 PE=2 SV=1) HSP 1 Score: 82.0 bits (201), Expect = 3.0e-15 Identity = 37/39 (94.87%), Postives = 36/39 (92.31%), Query Frame = 2
HSP 2 Score: 46.6 bits (109), Expect = 1.4e-04 Identity = 21/26 (80.77%), Postives = 21/26 (80.77%), Query Frame = 3
BLAST of WMU57289 vs. Swiss-Prot
Match: CCT13_ORYSJ (Cyclin-T1-3 OS=Oryza sativa subsp. japonica GN=CYCT1-3 PE=3 SV=2) HSP 1 Score: 78.2 bits (191), Expect = 4.4e-14 Identity = 36/39 (92.31%), Postives = 35/39 (89.74%), Query Frame = 2
HSP 2 Score: 46.6 bits (109), Expect = 1.4e-04 Identity = 21/26 (80.77%), Postives = 21/26 (80.77%), Query Frame = 3
BLAST of WMU57289 vs. Swiss-Prot
Match: CCT13_ARATH (Cyclin-T1-3 OS=Arabidopsis thaliana GN=CYCT1-3 PE=1 SV=2) HSP 1 Score: 68.2 bits (165), Expect = 4.5e-11 Identity = 31/45 (68.89%), Postives = 34/45 (75.56%), Query Frame = 2
BLAST of WMU57289 vs. NCBI nr
Match: gi|778664653|ref|XP_011660325.1| (PREDICTED: cyclin-T1-3 [Cucumis sativus]) HSP 1 Score: 96.7 bits (239), Expect = 1.9e-17 Identity = 45/45 (100.00%), Postives = 45/45 (100.00%), Query Frame = 2
BLAST of WMU57289 vs. NCBI nr
Match: gi|659118350|ref|XP_008459075.1| (PREDICTED: LOW QUALITY PROTEIN: cyclin-T1-5 [Cucumis melo]) HSP 1 Score: 96.7 bits (239), Expect = 1.9e-17 Identity = 45/45 (100.00%), Postives = 45/45 (100.00%), Query Frame = 2
BLAST of WMU57289 vs. NCBI nr
Match: gi|823245164|ref|XP_012455251.1| (PREDICTED: cyclin-T1-4 [Gossypium raimondii]) HSP 1 Score: 91.7 bits (226), Expect = 6.1e-16 Identity = 42/45 (93.33%), Postives = 43/45 (95.56%), Query Frame = 2
BLAST of WMU57289 vs. NCBI nr
Match: gi|590621708|ref|XP_007024847.1| (Cyclin family protein, putative isoform 1 [Theobroma cacao]) HSP 1 Score: 91.7 bits (226), Expect = 6.1e-16 Identity = 42/45 (93.33%), Postives = 43/45 (95.56%), Query Frame = 2
BLAST of WMU57289 vs. NCBI nr
Match: gi|296082684|emb|CBI21689.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 89.7 bits (221), Expect = 2.3e-15 Identity = 40/44 (90.91%), Postives = 43/44 (97.73%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|