WMU56400 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TGGGTCCGTTGGTAGAGGAAACATCAACAAGGTGTGGTCATATTTTCTGCAAGGCATGCGATTAGGGGCTGCAATAGCCGTCCAGAGTAAATGCCCCAACATGTAGGAAGAGAGTAACTGCCAAAGAACTGATTAGAGTATTCCTTCCTGGCACAAGCTTGGAATGAGGCTTGGCTTACATCTTACAGGATTTTGTTTTTGAAGACTTCGAAAGGAAATGGCTGAAGTTTTCTTGTAAGTAAGAAAAGCTAATTTTTAGGTGG
BLAST of WMU56400 vs. TAIR10
Match: AT5G48655.2 (AT5G48655.2 RING/U-box superfamily protein) HSP 1 Score: 63.2 bits (152), Expect = 9.4e-11 Identity = 31/50 (62.00%), Postives = 33/50 (66.00%), Query Frame = 3
BLAST of WMU56400 vs. TAIR10
Match: AT3G07200.1 (AT3G07200.1 RING/U-box superfamily protein) HSP 1 Score: 58.9 bits (141), Expect = 1.8e-09 Identity = 27/50 (54.00%), Postives = 31/50 (62.00%), Query Frame = 3
BLAST of WMU56400 vs. NCBI nr
Match: gi|449453284|ref|XP_004144388.1| (PREDICTED: E3 ubiquitin-protein ligase RNF4 [Cucumis sativus]) HSP 1 Score: 87.8 bits (216), Expect = 1.0e-14 Identity = 44/57 (77.19%), Postives = 45/57 (78.95%), Query Frame = 3
BLAST of WMU56400 vs. NCBI nr
Match: gi|659120828|ref|XP_008460369.1| (PREDICTED: E3 ubiquitin-protein ligase RNF4-like isoform X1 [Cucumis melo]) HSP 1 Score: 86.7 bits (213), Expect = 2.2e-14 Identity = 43/57 (75.44%), Postives = 45/57 (78.95%), Query Frame = 3
BLAST of WMU56400 vs. NCBI nr
Match: gi|659120837|ref|XP_008460373.1| (PREDICTED: E3 ubiquitin-protein ligase RNF4-like isoform X2 [Cucumis melo]) HSP 1 Score: 86.7 bits (213), Expect = 2.2e-14 Identity = 43/57 (75.44%), Postives = 45/57 (78.95%), Query Frame = 3
BLAST of WMU56400 vs. NCBI nr
Match: gi|1012033623|ref|XP_015952624.1| (PREDICTED: E3 ubiquitin-protein ligase RNF4-like [Arachis duranensis]) HSP 1 Score: 77.4 bits (189), Expect = 1.4e-11 Identity = 36/52 (69.23%), Postives = 39/52 (75.00%), Query Frame = 3
BLAST of WMU56400 vs. NCBI nr
Match: gi|1021487690|ref|XP_016186802.1| (PREDICTED: E3 ubiquitin-protein ligase RNF4-like [Arachis ipaensis]) HSP 1 Score: 77.4 bits (189), Expect = 1.4e-11 Identity = 36/52 (69.23%), Postives = 39/52 (75.00%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|