WMU54720 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GTTCACAAGGATGCAAGATTCCATTTTGAAATCAGAACCCACCAACGCCTCATCGATATTTTGTACCCTACTGCCCAAACAATCGATTCTTTGATGCAACTAGACCTTCCTGCTGGTGTCGACGTCGAGGTCAAGCTATGAAGAGAAAAGCTTCACCTAGGTAATGGGGTTTCTGAGGATGTAACTACTGATATATATCAGAGCCTGAAAATTGTGTAGACGATAATGATGGAACAGGTCTTAGAGACGATGGCTGGTCCTTACAGTATGCTTTTCTTTGCTTGAATTGCTATGCCAATATGGAAATGGAGCAATGGAAATATAGGACTGTTAAAATCACATTTTCCTTTTTGTTAGTTTCTTTGCTGCTTTGCAGTCTCTT
BLAST of WMU54720 vs. TAIR10
Match: AT3G13120.1 (AT3G13120.1 Ribosomal protein S10p/S20e family protein) HSP 1 Score: 94.4 bits (233), Expect = 5.5e-20 Identity = 45/46 (97.83%), Postives = 44/46 (95.65%), Query Frame = 1
BLAST of WMU54720 vs. Swiss-Prot
Match: RR10_MESCR (30S ribosomal protein S10, chloroplastic OS=Mesembryanthemum crystallinum GN=RPS10 PE=2 SV=1) HSP 1 Score: 95.1 bits (235), Expect = 5.8e-19 Identity = 46/46 (100.00%), Postives = 44/46 (95.65%), Query Frame = 1
BLAST of WMU54720 vs. Swiss-Prot
Match: RR10_ARATH (30S ribosomal protein S10, chloroplastic OS=Arabidopsis thaliana GN=RPS10 PE=2 SV=1) HSP 1 Score: 94.4 bits (233), Expect = 9.8e-19 Identity = 45/46 (97.83%), Postives = 44/46 (95.65%), Query Frame = 1
BLAST of WMU54720 vs. Swiss-Prot
Match: RS10_PROAC (30S ribosomal protein S10 OS=Propionibacterium acnes (strain KPA171202 / DSM 16379) GN=rpsJ PE=3 SV=1) HSP 1 Score: 74.3 bits (181), Expect = 1.1e-12 Identity = 33/45 (73.33%), Postives = 40/45 (88.89%), Query Frame = 1
BLAST of WMU54720 vs. Swiss-Prot
Match: RS10_FRASN (30S ribosomal protein S10 OS=Frankia sp. (strain EAN1pec) GN=rpsJ PE=3 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 1.4e-12 Identity = 33/45 (73.33%), Postives = 40/45 (88.89%), Query Frame = 1
BLAST of WMU54720 vs. Swiss-Prot
Match: RS10_FRAAA (30S ribosomal protein S10 OS=Frankia alni (strain ACN14a) GN=rpsJ PE=3 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 1.4e-12 Identity = 33/45 (73.33%), Postives = 40/45 (88.89%), Query Frame = 1
BLAST of WMU54720 vs. NCBI nr
Match: gi|147798522|emb|CAN74383.1| (hypothetical protein VITISV_023801 [Vitis vinifera]) HSP 1 Score: 95.1 bits (235), Expect = 9.2e-17 Identity = 46/46 (100.00%), Postives = 46/46 (100.00%), Query Frame = 1
BLAST of WMU54720 vs. NCBI nr
Match: gi|802588624|ref|XP_012070989.1| (PREDICTED: 30S ribosomal protein S10, chloroplastic [Jatropha curcas]) HSP 1 Score: 95.1 bits (235), Expect = 9.2e-17 Identity = 46/46 (100.00%), Postives = 46/46 (100.00%), Query Frame = 1
BLAST of WMU54720 vs. NCBI nr
Match: gi|595874114|ref|XP_007212084.1| (hypothetical protein PRUPE_ppa011713mg [Prunus persica]) HSP 1 Score: 95.1 bits (235), Expect = 9.2e-17 Identity = 46/46 (100.00%), Postives = 46/46 (100.00%), Query Frame = 1
BLAST of WMU54720 vs. NCBI nr
Match: gi|162945917|gb|ABY20970.1| (chloroplast 30S ribosomal protein S10, partial [Daucus carota]) HSP 1 Score: 95.1 bits (235), Expect = 9.2e-17 Identity = 46/46 (100.00%), Postives = 46/46 (100.00%), Query Frame = 1
BLAST of WMU54720 vs. NCBI nr
Match: gi|657987535|ref|XP_008385921.1| (PREDICTED: 30S ribosomal protein S10, chloroplastic [Malus domestica]) HSP 1 Score: 95.1 bits (235), Expect = 9.2e-17 Identity = 46/46 (100.00%), Postives = 46/46 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|