WMU49543 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CAATGTCTTGATGAGGCTTATGATAGGGAGATAATTGAAGAATAAGTTCCATTATCTCAAATTGTTCATGAGGTTGTGGCTCATCATGGTTTCTCACAGTTATGAGAAGAATTATGGAGTTGAAGATTGAGAATATGAAATGAGGACTTCCAAAAAGAATTACTACTTTGAAAAATTAGAGATGATTTT
BLAST of WMU49543 vs. NCBI nr
Match: gi|700200793|gb|KGN55926.1| (hypothetical protein Csa_3G036520 [Cucumis sativus]) HSP 1 Score: 57.8 bits (138), Expect = 8.0e-06 Identity = 26/30 (86.67%), Postives = 29/30 (96.67%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|