WMU49241 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GCTCATACATGAATGTCACGGTTGCTGCAGGCGACCATTTTGCATGATCTTTTACCAATGCCCCTTCCCTAGCTATGGCTCTCAGCCGCAACTCTTGACCACGACGTAGCTTCACAATGATTATTCCTCTACAATCATCACAAAACCAGCTCAAATTTTGGAGCAATTACTTAATGAACCACAATGACACCAAACTAAAACGATATTGTTCTCAAACATGTTGGAATGTTGCATAGAAATAACAAATTAGAACTTTGGTAGACCGAGCTTTA
BLAST of WMU49241 vs. TAIR10
Match: AT2G15430.1 (AT2G15430.1 DNA-directed RNA polymerase family protein) HSP 1 Score: 73.9 bits (180), Expect = 5.5e-14 Identity = 37/43 (86.05%), Postives = 39/43 (90.70%), Query Frame = -2
BLAST of WMU49241 vs. TAIR10
Match: AT2G15400.1 (AT2G15400.1 DNA-directed RNA polymerase family protein) HSP 1 Score: 69.3 bits (168), Expect = 1.4e-12 Identity = 33/43 (76.74%), Postives = 38/43 (88.37%), Query Frame = -2
BLAST of WMU49241 vs. Swiss-Prot
Match: NRPB3_ARATH (DNA-directed RNA polymerases II, IV and V subunit 3 OS=Arabidopsis thaliana GN=NRPB3 PE=1 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 9.8e-13 Identity = 37/43 (86.05%), Postives = 39/43 (90.70%), Query Frame = -2
BLAST of WMU49241 vs. Swiss-Prot
Match: RPD3B_ARATH (DNA-directed RNA polymerases IV and V subunit 3B OS=Arabidopsis thaliana GN=NRPD3B PE=1 SV=2) HSP 1 Score: 69.3 bits (168), Expect = 2.4e-11 Identity = 33/43 (76.74%), Postives = 38/43 (88.37%), Query Frame = -2
BLAST of WMU49241 vs. Swiss-Prot
Match: RPB3_BOVIN (DNA-directed RNA polymerase II subunit RPB3 OS=Bos taurus GN=POLR2C PE=1 SV=1) HSP 1 Score: 53.5 bits (127), Expect = 1.4e-06 Identity = 26/41 (63.41%), Postives = 31/41 (75.61%), Query Frame = -2
BLAST of WMU49241 vs. Swiss-Prot
Match: RPB3_HUMAN (DNA-directed RNA polymerase II subunit RPB3 OS=Homo sapiens GN=POLR2C PE=1 SV=2) HSP 1 Score: 53.5 bits (127), Expect = 1.4e-06 Identity = 26/41 (63.41%), Postives = 31/41 (75.61%), Query Frame = -2
BLAST of WMU49241 vs. Swiss-Prot
Match: RPB3_YEAST (DNA-directed RNA polymerase II subunit RPB3 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=RPB3 PE=1 SV=2) HSP 1 Score: 53.1 bits (126), Expect = 1.8e-06 Identity = 22/42 (52.38%), Postives = 31/42 (73.81%), Query Frame = -2
BLAST of WMU49241 vs. NCBI nr
Match: gi|567860602|ref|XP_006422955.1| (hypothetical protein CICLE_v10028849mg [Citrus clementina]) HSP 1 Score: 78.6 bits (192), Expect = 6.3e-12 Identity = 40/46 (86.96%), Postives = 42/46 (91.30%), Query Frame = -2
BLAST of WMU49241 vs. NCBI nr
Match: gi|357154558|ref|XP_003576823.1| (PREDICTED: DNA-directed RNA polymerases II, IV and V subunit 3-like [Brachypodium distachyon]) HSP 1 Score: 78.6 bits (192), Expect = 6.3e-12 Identity = 39/45 (86.67%), Postives = 42/45 (93.33%), Query Frame = -2
BLAST of WMU49241 vs. NCBI nr
Match: gi|357475219|ref|XP_003607895.1| (RPB3 DNA-directed RNA polymerase II subunit 3 [Medicago truncatula]) HSP 1 Score: 78.2 bits (191), Expect = 8.3e-12 Identity = 40/45 (88.89%), Postives = 42/45 (93.33%), Query Frame = -2
BLAST of WMU49241 vs. NCBI nr
Match: gi|703142874|ref|XP_010107867.1| (DNA-directed RNA polymerase II subunit [Morus notabilis]) HSP 1 Score: 78.2 bits (191), Expect = 8.3e-12 Identity = 40/45 (88.89%), Postives = 42/45 (93.33%), Query Frame = -2
BLAST of WMU49241 vs. NCBI nr
Match: gi|1012347744|gb|KYP58935.1| (DNA-directed RNA polymerase II subunit RPB3-A [Cajanus cajan]) HSP 1 Score: 78.2 bits (191), Expect = 8.3e-12 Identity = 40/45 (88.89%), Postives = 42/45 (93.33%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|