WMU49126 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AAGTCCAGAGTGGAGAACCTTCATGATTGATAAACAAACATCCAAACCAATGAAGTCTGCAAGCTCCAAGGGACCCATGGGGAGTGATTTTGTTTCCTAGCTTCATTCCCGTGTCGATGTCTTCCTTCGTTGCCACTCCCGTGAAGAGAGCAAAAATAGCCTCGTTAATCATCGGCATTAG
BLAST of WMU49126 vs. TAIR10
Match: AT3G15290.1 (AT3G15290.1 3-hydroxyacyl-CoA dehydrogenase family protein) HSP 1 Score: 52.4 bits (124), Expect = 1.1e-07 Identity = 23/26 (88.46%), Postives = 22/26 (84.62%), Query Frame = -2
HSP 2 Score: 49.3 bits (116), Expect = 9.7e-07 Identity = 23/29 (79.31%), Postives = 23/29 (79.31%), Query Frame = -1
BLAST of WMU49126 vs. Swiss-Prot
Match: HBD_BRADU (3-hydroxybutyryl-CoA dehydrogenase OS=Bradyrhizobium diazoefficiens (strain JCM 10833 / IAM 13628 / NBRC 14792 / USDA 110) GN=hbdA PE=3 SV=1) HSP 1 Score: 52.0 bits (123), Expect = 2.6e-06 Identity = 23/26 (88.46%), Postives = 22/26 (84.62%), Query Frame = -2
BLAST of WMU49126 vs. Swiss-Prot
Match: HBD_BACSU (Probable 3-hydroxybutyryl-CoA dehydrogenase OS=Bacillus subtilis (strain 168) GN=mmgB PE=2 SV=1) HSP 1 Score: 51.2 bits (121), Expect = 4.5e-06 Identity = 23/26 (88.46%), Postives = 22/26 (84.62%), Query Frame = -2
BLAST of WMU49126 vs. NCBI nr
Match: gi|1012080488|ref|XP_015954131.1| (PREDICTED: 3-hydroxybutyryl-CoA dehydrogenase [Arachis duranensis]) HSP 1 Score: 58.5 bits (140), Expect = 4.5e-06 Identity = 27/29 (93.10%), Postives = 28/29 (96.55%), Query Frame = -1
BLAST of WMU49126 vs. NCBI nr
Match: gi|586765202|ref|XP_006855240.1| (PREDICTED: probable 3-hydroxyacyl-CoA dehydrogenase B0272.3 [Amborella trichopoda]) HSP 1 Score: 58.5 bits (140), Expect = 4.5e-06 Identity = 27/29 (93.10%), Postives = 28/29 (96.55%), Query Frame = -1
BLAST of WMU49126 vs. NCBI nr
Match: gi|351722947|ref|NP_001234958.1| (peroxisomal 3-hydroxyacyl-CoA dehydrogenase-like protein [Glycine max]) HSP 1 Score: 58.5 bits (140), Expect = 4.5e-06 Identity = 27/29 (93.10%), Postives = 28/29 (96.55%), Query Frame = -1
BLAST of WMU49126 vs. NCBI nr
Match: gi|1021491576|ref|XP_016188803.1| (PREDICTED: 3-hydroxybutyryl-CoA dehydrogenase [Arachis ipaensis]) HSP 1 Score: 58.5 bits (140), Expect = 4.5e-06 Identity = 27/29 (93.10%), Postives = 28/29 (96.55%), Query Frame = -1
BLAST of WMU49126 vs. NCBI nr
Match: gi|449457019|ref|XP_004146246.1| (PREDICTED: hydroxyacyl-coenzyme A dehydrogenase, mitochondrial [Cucumis sativus]) HSP 1 Score: 58.5 bits (140), Expect = 4.5e-06 Identity = 27/29 (93.10%), Postives = 28/29 (96.55%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|