WMU48935 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AGTGGTTTCTCAAATGCTTTTGCCACAACTGGGCTGTGGGACAATGTTGAAGAGATTAGAGCTATGATGAGGAAATCAGGAATGAGTAAAGATCCTGGTTATAGCAGAATTGAGATTCAAAGGGAATTCCATATCTTTGTCAAGAGCGATAAATCTCATCGACAAACTGATGAGATTTATAGAACTATTAATAGGATAACTCCAATTTTGAAAGATGCAGGGTATATTCCTCAAGTATCTGAAAACTAATGGTAGAGATTAAATTACGATTTTGAAAAGTT
BLAST of WMU48935 vs. TAIR10
Match: AT3G49142.1 (AT3G49142.1 Tetratricopeptide repeat (TPR)-like superfamily protein) HSP 1 Score: 75.1 bits (183), Expect = 2.6e-14 Identity = 31/74 (41.89%), Postives = 46/74 (62.16%), Query Frame = 1
BLAST of WMU48935 vs. TAIR10
Match: AT4G16470.1 (AT4G16470.1 Tetratricopeptide repeat (TPR)-like superfamily protein) HSP 1 Score: 73.6 bits (179), Expect = 7.4e-14 Identity = 31/75 (41.33%), Postives = 47/75 (62.67%), Query Frame = 1
BLAST of WMU48935 vs. TAIR10
Match: AT4G33170.1 (AT4G33170.1 Tetratricopeptide repeat (TPR)-like superfamily protein) HSP 1 Score: 71.2 bits (173), Expect = 3.7e-13 Identity = 31/75 (41.33%), Postives = 46/75 (61.33%), Query Frame = 1
BLAST of WMU48935 vs. TAIR10
Match: AT4G21065.1 (AT4G21065.1 Tetratricopeptide repeat (TPR)-like superfamily protein) HSP 1 Score: 71.2 bits (173), Expect = 3.7e-13 Identity = 31/77 (40.26%), Postives = 46/77 (59.74%), Query Frame = 1
BLAST of WMU48935 vs. TAIR10
Match: AT2G03880.1 (AT2G03880.1 Pentatricopeptide repeat (PPR) superfamily protein) HSP 1 Score: 70.9 bits (172), Expect = 4.8e-13 Identity = 31/77 (40.26%), Postives = 46/77 (59.74%), Query Frame = 1
BLAST of WMU48935 vs. Swiss-Prot
Match: PP271_ARATH (Putative pentatricopeptide repeat-containing protein At3g49142 OS=Arabidopsis thaliana GN=PCMP-H77 PE=3 SV=1) HSP 1 Score: 75.1 bits (183), Expect = 4.5e-13 Identity = 31/74 (41.89%), Postives = 46/74 (62.16%), Query Frame = 1
BLAST of WMU48935 vs. Swiss-Prot
Match: PP315_ARATH (Pentatricopeptide repeat-containing protein At4g16470 OS=Arabidopsis thaliana GN=PCMP-E12 PE=2 SV=2) HSP 1 Score: 73.6 bits (179), Expect = 1.3e-12 Identity = 31/75 (41.33%), Postives = 47/75 (62.67%), Query Frame = 1
BLAST of WMU48935 vs. Swiss-Prot
Match: PP330_ARATH (Pentatricopeptide repeat-containing protein At4g21065 OS=Arabidopsis thaliana GN=PCMP-H28 PE=2 SV=2) HSP 1 Score: 71.2 bits (173), Expect = 6.5e-12 Identity = 31/77 (40.26%), Postives = 46/77 (59.74%), Query Frame = 1
BLAST of WMU48935 vs. Swiss-Prot
Match: PP347_ARATH (Pentatricopeptide repeat-containing protein At4g33170 OS=Arabidopsis thaliana GN=PCMP-H53 PE=3 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 6.5e-12 Identity = 31/75 (41.33%), Postives = 46/75 (61.33%), Query Frame = 1
BLAST of WMU48935 vs. Swiss-Prot
Match: PP147_ARATH (Pentatricopeptide repeat-containing protein At2g03880, mitochondrial OS=Arabidopsis thaliana GN=PCMP-H44 PE=2 SV=1) HSP 1 Score: 70.9 bits (172), Expect = 8.5e-12 Identity = 31/77 (40.26%), Postives = 46/77 (59.74%), Query Frame = 1
BLAST of WMU48935 vs. NCBI nr
Match: gi|449434032|ref|XP_004134800.1| (PREDICTED: pentatricopeptide repeat-containing protein At4g16470 [Cucumis sativus]) HSP 1 Score: 148.7 bits (374), Expect = 5.1e-33 Identity = 69/79 (87.34%), Postives = 76/79 (96.20%), Query Frame = 1
BLAST of WMU48935 vs. NCBI nr
Match: gi|659079107|ref|XP_008440079.1| (PREDICTED: pentatricopeptide repeat-containing protein At4g16470 [Cucumis melo]) HSP 1 Score: 146.0 bits (367), Expect = 3.3e-32 Identity = 67/79 (84.81%), Postives = 76/79 (96.20%), Query Frame = 1
BLAST of WMU48935 vs. NCBI nr
Match: gi|731440563|ref|XP_010647234.1| (PREDICTED: pentatricopeptide repeat-containing protein At4g16470-like isoform X1 [Vitis vinifera]) HSP 1 Score: 118.2 bits (295), Expect = 7.5e-24 Identity = 51/77 (66.23%), Postives = 63/77 (81.82%), Query Frame = 1
BLAST of WMU48935 vs. NCBI nr
Match: gi|296088921|emb|CBI38481.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 117.1 bits (292), Expect = 1.7e-23 Identity = 50/77 (64.94%), Postives = 63/77 (81.82%), Query Frame = 1
BLAST of WMU48935 vs. NCBI nr
Match: gi|590626887|ref|XP_007026296.1| (Tetratricopeptide repeat-like superfamily protein [Theobroma cacao]) HSP 1 Score: 100.5 bits (249), Expect = 1.6e-18 Identity = 44/77 (57.14%), Postives = 56/77 (72.73%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|