WMU48548 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CATTGTTGCGACTCACAACAGAGTTGATTACACCGGTTCCTCTGCCATGGAAAGCAATGAAAATGAAGAAACAGACTACAAAAACTTCCAATCCATGGCTGACATTGTGACATCCAAAT
BLAST of WMU48548 vs. NCBI nr
Match: gi|700201393|gb|KGN56526.1| (hypothetical protein Csa_3G122500 [Cucumis sativus]) HSP 1 Score: 68.2 bits (165), Expect = 3.7e-09 Identity = 36/40 (90.00%), Postives = 37/40 (92.50%), Query Frame = 2
BLAST of WMU48548 vs. NCBI nr
Match: gi|449432165|ref|XP_004133870.1| (PREDICTED: transcription repressor MYB6 [Cucumis sativus]) HSP 1 Score: 68.2 bits (165), Expect = 3.7e-09 Identity = 36/40 (90.00%), Postives = 37/40 (92.50%), Query Frame = 2
BLAST of WMU48548 vs. NCBI nr
Match: gi|659077729|ref|XP_008439352.1| (PREDICTED: transcription factor MYB34-like [Cucumis melo]) HSP 1 Score: 66.2 bits (160), Expect = 1.4e-08 Identity = 35/40 (87.50%), Postives = 37/40 (92.50%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|