WMU46448 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AGCTTCCGTTGCTGTCAGGTGTTTATATGCGAGGGCATCTCATGATTTGGTACCACAGGTAATATTGGCAACTCGGAGTCTTATTCAACTTGACAACAG
BLAST of WMU46448 vs. TAIR10
Match: AT5G64090.1 (AT5G64090.1 FUNCTIONS IN: molecular_function unknown) HSP 1 Score: 48.9 bits (115), Expect = 6.7e-07 Identity = 25/31 (80.65%), Postives = 24/31 (77.42%), Query Frame = 2
BLAST of WMU46448 vs. NCBI nr
Match: gi|659111243|ref|XP_008455651.1| (PREDICTED: LOW QUALITY PROTEIN: uncharacterized protein LOC103495769 [Cucumis melo]) HSP 1 Score: 63.5 bits (153), Expect = 7.5e-08 Identity = 32/32 (100.00%), Postives = 32/32 (100.00%), Query Frame = 2
BLAST of WMU46448 vs. NCBI nr
Match: gi|449438789|ref|XP_004137170.1| (PREDICTED: uncharacterized protein LOC101215901 [Cucumis sativus]) HSP 1 Score: 63.5 bits (153), Expect = 7.5e-08 Identity = 32/32 (100.00%), Postives = 32/32 (100.00%), Query Frame = 2
BLAST of WMU46448 vs. NCBI nr
Match: gi|502142071|ref|XP_004504778.1| (PREDICTED: uncharacterized protein LOC101491587 [Cicer arietinum]) HSP 1 Score: 60.1 bits (144), Expect = 8.3e-07 Identity = 30/32 (93.75%), Postives = 30/32 (93.75%), Query Frame = 2
BLAST of WMU46448 vs. NCBI nr
Match: gi|922370081|ref|XP_013457204.1| (hyccin protein [Medicago truncatula]) HSP 1 Score: 60.1 bits (144), Expect = 8.3e-07 Identity = 30/32 (93.75%), Postives = 30/32 (93.75%), Query Frame = 2
BLAST of WMU46448 vs. NCBI nr
Match: gi|731410559|ref|XP_010657604.1| (PREDICTED: uncharacterized protein LOC100257164 [Vitis vinifera]) HSP 1 Score: 59.7 bits (143), Expect = 1.1e-06 Identity = 30/31 (96.77%), Postives = 30/31 (96.77%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|