WMU45759 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AAACGACGCCGCACCAGCAAGAAACGCCGGAGTATAAGCCAAGAGCATTCCGTATTTGGACGAAAGCTTAGTTTCTTCCGATGAATGTTTCGGAACACTATTCGCATTCCAGAACTTGGAATACTGCAAATGCTTACCGTTAATCTCGGAAATTCCAGCCATGGCCATCGCGGTCGAGCTTACTACCGTCATCACGTTCACGAACGTGGAAGGAGGCGGAGGAGAGAAACGCCGACAAAACGTACCATCGCTGCCGAGACTCAGATGGGAAAAAGCTTCTGAAGAAGTTT
BLAST of WMU45759 vs. TAIR10
Match: AT5G16010.1 (AT5G16010.1 3-oxo-5-alpha-steroid 4-dehydrogenase family protein) HSP 1 Score: 77.4 bits (189), Expect = 5.3e-15 Identity = 41/75 (54.67%), Postives = 49/75 (65.33%), Query Frame = -3
BLAST of WMU45759 vs. NCBI nr
Match: gi|778706250|ref|XP_004135052.2| (PREDICTED: 3-oxo-5-alpha-steroid 4-dehydrogenase 2-like [Cucumis sativus]) HSP 1 Score: 130.6 bits (327), Expect = 1.5e-27 Identity = 64/74 (86.49%), Postives = 70/74 (94.59%), Query Frame = -3
BLAST of WMU45759 vs. NCBI nr
Match: gi|700196982|gb|KGN52159.1| (hypothetical protein Csa_5G612880 [Cucumis sativus]) HSP 1 Score: 130.6 bits (327), Expect = 1.5e-27 Identity = 64/74 (86.49%), Postives = 70/74 (94.59%), Query Frame = -3
BLAST of WMU45759 vs. NCBI nr
Match: gi|659091769|ref|XP_008446722.1| (PREDICTED: 3-oxo-5-alpha-steroid 4-dehydrogenase 2-like [Cucumis melo]) HSP 1 Score: 127.1 bits (318), Expect = 1.7e-26 Identity = 63/74 (85.14%), Postives = 69/74 (93.24%), Query Frame = -3
BLAST of WMU45759 vs. NCBI nr
Match: gi|922352099|ref|XP_013451866.1| (3-oxo-5-alpha-steroid 4-dehydrogenase family protein [Medicago truncatula]) HSP 1 Score: 95.9 bits (237), Expect = 4.1e-17 Identity = 48/74 (64.86%), Postives = 56/74 (75.68%), Query Frame = -3
BLAST of WMU45759 vs. NCBI nr
Match: gi|922352101|ref|XP_013451867.1| (3-oxo-5-alpha-steroid 4-dehydrogenase family protein [Medicago truncatula]) HSP 1 Score: 95.9 bits (237), Expect = 4.1e-17 Identity = 48/74 (64.86%), Postives = 56/74 (75.68%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|