WMU44595 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CGGTGCCGACGGCCTGGTCCTGATTCAGAGCGGCGCCGTTGTACGGAGAGATTGGAACGGCGTTACCGACGAGGAACGGAGACCAGATGTTGAGATCGTTGTGGCCTTGGTAGGTAGGTTGAATGACGGTACGGAGAGTGATCTGTTGGTTCCGGTAAACGGCGTAGACGTCGAGGCGGTCGTAGTAGATGCCGATCTTGTCGTTAGGGCTCCGGGAGGAGACGGTGACTTGGATACTGGAGGAGATAAAAGTTAGCGGCGGTGACATTGAAGATGAAGACGGTGGCGTCTTGGATGCCCCCGTAATGGCCGACCTCTGCGTTGTATACCACCTGCT
BLAST of WMU44595 vs. TAIR10
Match: AT3G52470.1 (AT3G52470.1 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family) HSP 1 Score: 105.1 bits (261), Expect = 2.8e-23 Identity = 46/68 (67.65%), Postives = 52/68 (76.47%), Query Frame = -1
BLAST of WMU44595 vs. TAIR10
Match: AT3G11660.1 (AT3G11660.1 NDR1/HIN1-like 1) HSP 1 Score: 102.8 bits (255), Expect = 1.4e-22 Identity = 45/68 (66.18%), Postives = 54/68 (79.41%), Query Frame = -1
BLAST of WMU44595 vs. TAIR10
Match: AT2G35960.1 (AT2G35960.1 NDR1/HIN1-like 12) HSP 1 Score: 102.1 bits (253), Expect = 2.3e-22 Identity = 45/67 (67.16%), Postives = 51/67 (76.12%), Query Frame = -1
BLAST of WMU44595 vs. TAIR10
Match: AT3G44220.1 (AT3G44220.1 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family) HSP 1 Score: 101.3 bits (251), Expect = 4.0e-22 Identity = 44/68 (64.71%), Postives = 51/68 (75.00%), Query Frame = -1
BLAST of WMU44595 vs. TAIR10
Match: AT5G22200.1 (AT5G22200.1 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family) HSP 1 Score: 99.4 bits (246), Expect = 1.5e-21 Identity = 40/68 (58.82%), Postives = 53/68 (77.94%), Query Frame = -1
BLAST of WMU44595 vs. Swiss-Prot
Match: NHL12_ARATH (NDR1/HIN1-like protein 12 OS=Arabidopsis thaliana GN=NHL12 PE=2 SV=1) HSP 1 Score: 102.1 bits (253), Expect = 4.2e-21 Identity = 45/67 (67.16%), Postives = 51/67 (76.12%), Query Frame = -1
BLAST of WMU44595 vs. NCBI nr
Match: gi|659125306|ref|XP_008462618.1| (PREDICTED: protein YLS9-like [Cucumis melo]) HSP 1 Score: 144.1 bits (362), Expect = 1.5e-31 Identity = 66/69 (95.65%), Postives = 68/69 (98.55%), Query Frame = -1
BLAST of WMU44595 vs. NCBI nr
Match: gi|449451173|ref|XP_004143336.1| (PREDICTED: protein YLS9 [Cucumis sativus]) HSP 1 Score: 137.9 bits (346), Expect = 1.1e-29 Identity = 62/69 (89.86%), Postives = 65/69 (94.20%), Query Frame = -1
BLAST of WMU44595 vs. NCBI nr
Match: gi|224138358|ref|XP_002322794.1| (harpin-induced family protein [Populus trichocarpa]) HSP 1 Score: 116.7 bits (291), Expect = 2.6e-23 Identity = 49/69 (71.01%), Postives = 60/69 (86.96%), Query Frame = -1
BLAST of WMU44595 vs. NCBI nr
Match: gi|698514525|ref|XP_009802139.1| (PREDICTED: protein YLS9-like [Nicotiana sylvestris]) HSP 1 Score: 115.5 bits (288), Expect = 5.8e-23 Identity = 50/69 (72.46%), Postives = 60/69 (86.96%), Query Frame = -1
BLAST of WMU44595 vs. NCBI nr
Match: gi|743898624|ref|XP_011042605.1| (PREDICTED: protein YLS9-like [Populus euphratica]) HSP 1 Score: 115.2 bits (287), Expect = 7.6e-23 Identity = 48/69 (69.57%), Postives = 60/69 (86.96%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|