WMU44513 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CCAAAAAGTCGTCAAGAACAGCCTTCATCCTAGAAGCTACTATCGTTGCACGCATAGCAACTGCCGAGTGAAGAAGAGAGTGGAGAGACTGTCGGAGGATTGCCGGATGGTGATAACCACCTACGAAGGTAGACACAACCACTCTCCTTGCGACGACTCCAATTCTTCAGAGCACGAACCCTTTACATCCTTCTGACTTCCATTTTTATTTTATATTTCTTTTCTTATATCCTGCTGCCATCCTAATTTCATTTCCCCCTTCCTTTCCTTTCCTTAATTCCTTTGCTTGTATAATAATAATAATTATTATTATTATTATTTCTTTAACTTT
BLAST of WMU44513 vs. TAIR10
Match: AT2G44745.1 (AT2G44745.1 WRKY family transcription factor) HSP 1 Score: 120.2 bits (300), Expect = 8.2e-28 Identity = 54/64 (84.38%), Postives = 56/64 (87.50%), Query Frame = 2
BLAST of WMU44513 vs. TAIR10
Match: AT4G39410.1 (AT4G39410.1 WRKY DNA-binding protein 13) HSP 1 Score: 92.4 bits (228), Expect = 1.8e-19 Identity = 47/70 (67.14%), Postives = 52/70 (74.29%), Query Frame = 2
BLAST of WMU44513 vs. TAIR10
Match: AT1G64000.1 (AT1G64000.1 WRKY DNA-binding protein 56) HSP 1 Score: 76.3 bits (186), Expect = 1.4e-14 Identity = 33/51 (64.71%), Postives = 41/51 (80.39%), Query Frame = 2
BLAST of WMU44513 vs. TAIR10
Match: AT2G37260.1 (AT2G37260.1 WRKY family transcription factor family protein) HSP 1 Score: 75.1 bits (183), Expect = 3.0e-14 Identity = 36/63 (57.14%), Postives = 40/63 (63.49%), Query Frame = 2
HSP 2 Score: 55.1 bits (131), Expect = 3.2e-08 Identity = 27/48 (56.25%), Postives = 31/48 (64.58%), Query Frame = 2
BLAST of WMU44513 vs. TAIR10
Match: AT5G41570.1 (AT5G41570.1 WRKY DNA-binding protein 24) HSP 1 Score: 74.3 bits (181), Expect = 5.1e-14 Identity = 32/51 (62.75%), Postives = 41/51 (80.39%), Query Frame = 2
BLAST of WMU44513 vs. Swiss-Prot
Match: WRK12_ARATH (Probable WRKY transcription factor 12 OS=Arabidopsis thaliana GN=WRKY12 PE=2 SV=1) HSP 1 Score: 120.2 bits (300), Expect = 1.5e-26 Identity = 54/64 (84.38%), Postives = 56/64 (87.50%), Query Frame = 2
BLAST of WMU44513 vs. Swiss-Prot
Match: WRK13_ARATH (Probable WRKY transcription factor 13 OS=Arabidopsis thaliana GN=WRKY13 PE=2 SV=1) HSP 1 Score: 92.4 bits (228), Expect = 3.2e-18 Identity = 47/70 (67.14%), Postives = 52/70 (74.29%), Query Frame = 2
BLAST of WMU44513 vs. Swiss-Prot
Match: WRK56_ARATH (Probable WRKY transcription factor 56 OS=Arabidopsis thaliana GN=WRKY56 PE=2 SV=1) HSP 1 Score: 76.3 bits (186), Expect = 2.4e-13 Identity = 33/51 (64.71%), Postives = 41/51 (80.39%), Query Frame = 2
BLAST of WMU44513 vs. Swiss-Prot
Match: WRK44_ARATH (WRKY transcription factor 44 OS=Arabidopsis thaliana GN=WRKY44 PE=1 SV=2) HSP 1 Score: 75.1 bits (183), Expect = 5.4e-13 Identity = 36/63 (57.14%), Postives = 40/63 (63.49%), Query Frame = 2
HSP 2 Score: 55.1 bits (131), Expect = 5.7e-07 Identity = 27/48 (56.25%), Postives = 31/48 (64.58%), Query Frame = 2
BLAST of WMU44513 vs. Swiss-Prot
Match: WRK24_ARATH (Probable WRKY transcription factor 24 OS=Arabidopsis thaliana GN=WRKY24 PE=2 SV=1) HSP 1 Score: 74.3 bits (181), Expect = 9.1e-13 Identity = 32/51 (62.75%), Postives = 41/51 (80.39%), Query Frame = 2
BLAST of WMU44513 vs. NCBI nr
Match: gi|659074721|ref|XP_008437760.1| (PREDICTED: probable WRKY transcription factor 12 [Cucumis melo]) HSP 1 Score: 140.6 bits (353), Expect = 1.7e-30 Identity = 64/64 (100.00%), Postives = 64/64 (100.00%), Query Frame = 2
BLAST of WMU44513 vs. NCBI nr
Match: gi|449431940|ref|XP_004133758.1| (PREDICTED: probable WRKY transcription factor 12 [Cucumis sativus]) HSP 1 Score: 139.4 bits (350), Expect = 3.7e-30 Identity = 63/64 (98.44%), Postives = 64/64 (100.00%), Query Frame = 2
BLAST of WMU44513 vs. NCBI nr
Match: gi|1000951459|ref|XP_015579263.1| (PREDICTED: probable WRKY transcription factor 12 [Ricinus communis]) HSP 1 Score: 136.7 bits (343), Expect = 2.4e-29 Identity = 63/64 (98.44%), Postives = 63/64 (98.44%), Query Frame = 2
BLAST of WMU44513 vs. NCBI nr
Match: gi|802700455|ref|XP_012083720.1| (PREDICTED: probable WRKY transcription factor 12 [Jatropha curcas]) HSP 1 Score: 136.7 bits (343), Expect = 2.4e-29 Identity = 63/64 (98.44%), Postives = 63/64 (98.44%), Query Frame = 2
BLAST of WMU44513 vs. NCBI nr
Match: gi|976914321|gb|KVI00540.1| (DNA-binding WRKY, partial [Cynara cardunculus var. scolymus]) HSP 1 Score: 135.6 bits (340), Expect = 5.3e-29 Identity = 62/64 (96.88%), Postives = 63/64 (98.44%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|