WMU37372 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GGTTACGGAAAATAGCCATCTCTATGAGTATGAGTGCAGCAAGTAACAGGTCGGATTGGTTCGGAAAGAAAATTCTCTCCTCACCCTCCACCCGTAGCAGCGAGGAAGAACAAAATCATTTTTATTATCCATGAAAGGAAAGTAGTTGAAGCAAATTGGAATCTGCATCGTTGCAATAGTTGAATCTCGTCCTCAGAAGTGCTGAAATTTTCTTAGGGCCTCAGGCAATGTCTTCCTACGATAATGTTGTTGGTGGGAAGTTGAAGCTTAAAGGGAAAGCTCTTGATGTGAAAGTAGGTGGGGTGAAGAAAAAAAGAAACCTAAAAAGAATCAAGATCAAAATATCTCTAGAGCTGGAGAATGAGCATCCGGCAGGTGGAAGTGCTGCCAGTGGTGAAATGGCAAGTGATGCGAATGAGGAAGAAATAGATGAAGCCAACAAGTCAACTGAGGATGGGAAGGTTCCTCACTATGATGATCATCTAACACCAGCGGAAAAACGTTATATTGAACAGAAGGAGAGAATTGATGTTCATAAGAACTAGGACCAAGAAAGCTAATAAATCTCATCGTGACC
BLAST of WMU37372 vs. TAIR10
Match: AT1G16810.1 (AT1G16810.1 unknown protein) HSP 1 Score: 52.8 bits (125), Expect = 2.8e-07 Identity = 24/44 (54.55%), Postives = 32/44 (72.73%), Query Frame = 3
BLAST of WMU37372 vs. TrEMBL
Match: A0A0A0LE92_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G640580 PE=4 SV=1) HSP 1 Score: 87.8 bits (216), Expect = 1.5e-14 Identity = 39/42 (92.86%), Postives = 42/42 (100.00%), Query Frame = 3
BLAST of WMU37372 vs. TrEMBL
Match: M5XB95_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa013180mg PE=4 SV=1) HSP 1 Score: 75.9 bits (185), Expect = 6.1e-11 Identity = 32/42 (76.19%), Postives = 39/42 (92.86%), Query Frame = 3
BLAST of WMU37372 vs. TrEMBL
Match: A0A061G9R4_THECC (Uncharacterized protein OS=Theobroma cacao GN=TCM_027792 PE=4 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 4.3e-09 Identity = 28/41 (68.29%), Postives = 38/41 (92.68%), Query Frame = 3
BLAST of WMU37372 vs. TrEMBL
Match: A0A0B0PTN0_GOSAR (Protein FAM32A-like protein OS=Gossypium arboreum GN=F383_11884 PE=4 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 6.3e-08 Identity = 27/42 (64.29%), Postives = 36/42 (85.71%), Query Frame = 3
BLAST of WMU37372 vs. TrEMBL
Match: A0A0D2TI94_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_009G119200 PE=4 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 6.3e-08 Identity = 27/42 (64.29%), Postives = 36/42 (85.71%), Query Frame = 3
BLAST of WMU37372 vs. NCBI nr
Match: gi|449453340|ref|XP_004144416.1| (PREDICTED: protein FAM32A [Cucumis sativus]) HSP 1 Score: 96.3 bits (238), Expect = 6.2e-17 Identity = 47/65 (72.31%), Postives = 50/65 (76.92%), Query Frame = 3
BLAST of WMU37372 vs. NCBI nr
Match: gi|659130305|ref|XP_008465099.1| (PREDICTED: protein FAM32A [Cucumis melo]) HSP 1 Score: 94.4 bits (233), Expect = 2.4e-16 Identity = 46/65 (70.77%), Postives = 50/65 (76.92%), Query Frame = 3
BLAST of WMU37372 vs. NCBI nr
Match: gi|700203283|gb|KGN58416.1| (hypothetical protein Csa_3G640580 [Cucumis sativus]) HSP 1 Score: 85.5 bits (210), Expect = 1.1e-13 Identity = 39/42 (92.86%), Postives = 42/42 (100.00%), Query Frame = 3
BLAST of WMU37372 vs. NCBI nr
Match: gi|645243455|ref|XP_008227982.1| (PREDICTED: protein FAM32A-like [Prunus mume]) HSP 1 Score: 73.6 bits (179), Expect = 4.3e-10 Identity = 32/42 (76.19%), Postives = 39/42 (92.86%), Query Frame = 3
BLAST of WMU37372 vs. NCBI nr
Match: gi|595928676|ref|XP_007215136.1| (hypothetical protein PRUPE_ppa013180mg [Prunus persica]) HSP 1 Score: 73.6 bits (179), Expect = 4.3e-10 Identity = 32/42 (76.19%), Postives = 39/42 (92.86%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|