WMU30262 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CTGGGACCCTGCGGAGCAAATTTTGTTGCTCAGGGTCCTCTCGTTCTCTCTCTCTGCCCCTTTGATCCAAATCTTCACCCACCTGTTCTTGTTTCTTCCTTCTTCCCTAGCTTTCCACTGCTCCTACTTCAGCTCCGATTTCTCTACATCTAGGAATAAACCTGGGCTTTTCTTTCAACTGTTGCATTTTGAGAGGAAGATGTCATCTATTGGTGAAGACACCCATTGGTGCTATCAATGCAACCATTCATTCTGGCTTGATGGAGAAGACGTAGTTTGCCCTTATTGTAACGGTGGTTTCGTTGAAGAACTTAACGAAGAACATGATGAAACGGTTCAAAATGACTTTAATTTCAGGCACAGAAGAAGATATTTCAACCCAGGTGCCTCCAATTTTTGAAGCCATGTTTGCATTGATGGGACGAAGAAGCCCTTATCCAAGATTTGGTCTTCTCGAAGCCGTTGATACTTTTACCAGAGAGAGAATGGCTGGAAGAAATCCTAACTTCGACGTTAGGAGGAGATCTGGTTCTGTCCAGGGCAGTAAG
BLAST of WMU30262 vs. TAIR10
Match: AT3G56580.2 (AT3G56580.2 RING/U-box superfamily protein) HSP 1 Score: 55.8 bits (133), Expect = 3.1e-08 Identity = 22/39 (56.41%), Postives = 26/39 (66.67%), Query Frame = 2
BLAST of WMU30262 vs. TAIR10
Match: AT2G40830.2 (AT2G40830.2 RING-H2 finger C1A) HSP 1 Score: 50.1 bits (118), Expect = 1.7e-06 Identity = 19/37 (51.35%), Postives = 24/37 (64.86%), Query Frame = 2
BLAST of WMU30262 vs. TAIR10
Match: AT3G46620.1 (AT3G46620.1 zinc finger (C3HC4-type RING finger) family protein) HSP 1 Score: 48.9 bits (115), Expect = 3.8e-06 Identity = 20/44 (45.45%), Postives = 26/44 (59.09%), Query Frame = 2
BLAST of WMU30262 vs. TrEMBL
Match: A0A0A0LZS8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G600760 PE=4 SV=1) HSP 1 Score: 122.9 bits (307), Expect = 4.1e-25 Identity = 59/62 (95.16%), Postives = 60/62 (96.77%), Query Frame = 3
BLAST of WMU30262 vs. TrEMBL
Match: A0A0A0LZS8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G600760 PE=4 SV=1) HSP 1 Score: 117.9 bits (294), Expect = 1.3e-23 Identity = 61/104 (58.65%), Postives = 67/104 (64.42%), Query Frame = 2
HSP 2 Score: 69.3 bits (168), Expect = 5.4e-09 Identity = 33/52 (63.46%), Postives = 40/52 (76.92%), Query Frame = 3
BLAST of WMU30262 vs. TrEMBL
Match: A0A151QZ96_CAJCA (RING finger protein 126 family OS=Cajanus cajan GN=KK1_043322 PE=4 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 2.5e-06 Identity = 23/44 (52.27%), Postives = 30/44 (68.18%), Query Frame = 2
HSP 2 Score: 69.3 bits (168), Expect = 5.4e-09 Identity = 33/52 (63.46%), Postives = 40/52 (76.92%), Query Frame = 3
BLAST of WMU30262 vs. TrEMBL
Match: I1M784_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_14G039000 PE=4 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 9.6e-06 Identity = 22/33 (66.67%), Postives = 25/33 (75.76%), Query Frame = 2
HSP 2 Score: 69.3 bits (168), Expect = 5.4e-09 Identity = 33/52 (63.46%), Postives = 40/52 (76.92%), Query Frame = 3
BLAST of WMU30262 vs. TrEMBL
Match: A0A0B2R254_GLYSO (E3 ubiquitin-protein ligase RING1-like OS=Glycine soja GN=glysoja_038229 PE=4 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 9.6e-06 Identity = 22/33 (66.67%), Postives = 25/33 (75.76%), Query Frame = 2
HSP 2 Score: 68.6 bits (166), Expect = 9.2e-09 Identity = 32/51 (62.75%), Postives = 39/51 (76.47%), Query Frame = 3
BLAST of WMU30262 vs. NCBI nr
Match: gi|449452702|ref|XP_004144098.1| (PREDICTED: E3 ubiquitin-protein ligase RNF126-B-like [Cucumis sativus]) HSP 1 Score: 123.2 bits (308), Expect = 4.5e-25 Identity = 59/62 (95.16%), Postives = 60/62 (96.77%), Query Frame = 3
BLAST of WMU30262 vs. NCBI nr
Match: gi|700211291|gb|KGN66387.1| (hypothetical protein Csa_1G600760 [Cucumis sativus]) HSP 1 Score: 123.2 bits (308), Expect = 4.5e-25 Identity = 59/62 (95.16%), Postives = 60/62 (96.77%), Query Frame = 3
BLAST of WMU30262 vs. NCBI nr
Match: gi|659100327|ref|XP_008451039.1| (PREDICTED: E3 ubiquitin-protein ligase RING1-like [Cucumis melo]) HSP 1 Score: 122.1 bits (305), Expect = 1.0e-24 Identity = 58/62 (93.55%), Postives = 60/62 (96.77%), Query Frame = 3
BLAST of WMU30262 vs. NCBI nr
Match: gi|1021488476|ref|XP_016187219.1| (PREDICTED: E3 ubiquitin-protein ligase RING1-like [Arachis ipaensis]) HSP 1 Score: 75.9 bits (185), Expect = 8.3e-11 Identity = 34/54 (62.96%), Postives = 41/54 (75.93%), Query Frame = 3
BLAST of WMU30262 vs. NCBI nr
Match: gi|1012202077|ref|XP_015973474.1| (PREDICTED: E3 ubiquitin-protein ligase RING1-like [Arachis duranensis]) HSP 1 Score: 75.9 bits (185), Expect = 8.3e-11 Identity = 34/54 (62.96%), Postives = 41/54 (75.93%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|