WMU22051 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CGTAAAAGAGACATGAAGGGAAGTTCTTTTTCCACCGATTATTTAGAATCAACATCCACTCAAAAATGTGAGGCAGATTAGAACTGCTAGACTAGGATGTACTTCCAAAAGCAGAATGATCCAATCACAAGTGTAAAAACTGACAACCAGAGTAATATTTTATTGCTTCAGGGCGGGTTTTGACGATGAAATTCTGGCGACTGATGGGGTTCATGACCACTGGTGGACCGGCAGTACGAGGCCATGCTTGGAATTTCTTGTCAAGTTTCTTCCCACCACTCGCTGTTGGAAACAGTACTTGGGGTTGTTCCTCCAAATATTTTCTTGTCAGCAACAAGATGGTCAGAAATATACGCAACTGCAGTTGCGCCAAGCAAAGAACCTACTATGTATTTTGCTGCCATCTTCTAACGATGAAAATAGATGTACAGAATCAAGGAGCCGTCAGATTGAGCCGATTTTTGAAGCGATGAAGCTGAGAGAAAGAGAGATTGGGGAAAATGAAGAAGATGGAAGGGGAAGGAGAGATCTCAAGCAGGGCGTGCCCTAGATGTTGTGAGAGAGACGAGATTGAGTCAAGAAAGAATATGGAAGGGGAAGGAGAGAACTTAGTCACCC
BLAST of WMU22051 vs. TAIR10
Match: AT1G01170.1 (AT1G01170.1 Protein of unknown function (DUF1138)) HSP 1 Score: 70.1 bits (170), Expect = 1.8e-12 Identity = 31/32 (96.88%), Postives = 30/32 (93.75%), Query Frame = -3
HSP 2 Score: 67.4 bits (163), Expect = 1.2e-11 Identity = 27/45 (60.00%), Postives = 34/45 (75.56%), Query Frame = -2
BLAST of WMU22051 vs. TAIR10
Match: AT4G00860.1 (AT4G00860.1 Protein of unknown function (DUF1138)) HSP 1 Score: 62.8 bits (151), Expect = 2.9e-10 Identity = 27/36 (75.00%), Postives = 29/36 (80.56%), Query Frame = -3
HSP 2 Score: 58.5 bits (140), Expect = 5.4e-09 Identity = 23/45 (51.11%), Postives = 31/45 (68.89%), Query Frame = -2
BLAST of WMU22051 vs. TrEMBL
Match: A0A0A0KYC7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G166930 PE=4 SV=1) HSP 1 Score: 85.9 bits (211), Expect = 6.3e-14 Identity = 41/47 (87.23%), Postives = 43/47 (91.49%), Query Frame = -2
BLAST of WMU22051 vs. TrEMBL
Match: A0A0A0KYC7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G166930 PE=4 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 7.2e-10 Identity = 32/36 (88.89%), Postives = 35/36 (97.22%), Query Frame = -3
HSP 2 Score: 79.3 bits (194), Expect = 5.9e-12 Identity = 34/47 (72.34%), Postives = 41/47 (87.23%), Query Frame = -2
BLAST of WMU22051 vs. TrEMBL
Match: A0A061EWV8_THECC (Uncharacterized protein OS=Theobroma cacao GN=TCM_024708 PE=4 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 1.5e-07 Identity = 29/36 (80.56%), Postives = 32/36 (88.89%), Query Frame = -3
HSP 2 Score: 78.2 bits (191), Expect = 1.3e-11 Identity = 35/47 (74.47%), Postives = 41/47 (87.23%), Query Frame = -2
BLAST of WMU22051 vs. TrEMBL
Match: A0A0B0MGC6_GOSAR (Monopolar spindle 2 OS=Gossypium arboreum GN=F383_19537 PE=4 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 1.5e-07 Identity = 29/35 (82.86%), Postives = 32/35 (91.43%), Query Frame = -3
HSP 2 Score: 77.4 bits (189), Expect = 2.2e-11 Identity = 35/47 (74.47%), Postives = 40/47 (85.11%), Query Frame = -2
BLAST of WMU22051 vs. TrEMBL
Match: A0A0D2NRU0_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_002G230600 PE=4 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 1.1e-07 Identity = 29/36 (80.56%), Postives = 33/36 (91.67%), Query Frame = -3
HSP 2 Score: 77.4 bits (189), Expect = 2.2e-11 Identity = 34/46 (73.91%), Postives = 41/46 (89.13%), Query Frame = -2
BLAST of WMU22051 vs. NCBI nr
Match: gi|659134221|ref|XP_008467091.1| (PREDICTED: uncharacterized protein LOC103504527 [Cucumis melo]) HSP 1 Score: 95.1 bits (235), Expect = 1.5e-16 Identity = 44/47 (93.62%), Postives = 46/47 (97.87%), Query Frame = -2
BLAST of WMU22051 vs. NCBI nr
Match: gi|449463344|ref|XP_004149394.1| (PREDICTED: uncharacterized protein LOC101213065 [Cucumis sativus]) HSP 1 Score: 85.9 bits (211), Expect = 9.0e-14 Identity = 41/47 (87.23%), Postives = 43/47 (91.49%), Query Frame = -2
BLAST of WMU22051 vs. NCBI nr
Match: gi|590636108|ref|XP_007028779.1| (Uncharacterized protein TCM_024708 [Theobroma cacao]) HSP 1 Score: 79.3 bits (194), Expect = 8.5e-12 Identity = 34/47 (72.34%), Postives = 41/47 (87.23%), Query Frame = -2
BLAST of WMU22051 vs. NCBI nr
Match: gi|728810096|gb|KHF99441.1| (Monopolar spindle 2 [Gossypium arboreum]) HSP 1 Score: 78.2 bits (191), Expect = 1.9e-11 Identity = 35/47 (74.47%), Postives = 41/47 (87.23%), Query Frame = -2
BLAST of WMU22051 vs. NCBI nr
Match: gi|823136581|ref|XP_012468054.1| (PREDICTED: uncharacterized protein LOC105786244 [Gossypium raimondii]) HSP 1 Score: 77.4 bits (189), Expect = 3.2e-11 Identity = 35/47 (74.47%), Postives = 40/47 (85.11%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|