WMU11266 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CTTTACCTTCATCAACATCATCATCATCATCATCACCATCATCATCATATTCTTCTTCTCAAAACCTCACTCATGGCGGAAAAAGGCAGTAGCAGTCCATTACCAAAGTTCGGCGAATGGGATGTCAATGACCCAGCATCCGCCGAGGGATTCACGGTAATCTTTAATAAAGCCAGGAATGAGAAAAGACTGGTGGCATGCCTGACTCTCCAGCAAAGGATGATCCCACATACAAGAATGGTTCTGTTCTTGGAAAGTCTCAACCTAAAATAGGTTTTGCTGCTTGCAAGCTGCAGAATCGTGAAGCTTTCTCGGTTCGATAAATGGGGTTCGAGCAGAAATAGTATAATACTGCAAATTACTTCAACAACACGAGTGAAGCTGTATT
BLAST of WMU11266 vs. TAIR10
Match: AT2G04410.1 (AT2G04410.1 RPM1-interacting protein 4 (RIN4) family protein) HSP 1 Score: 70.5 bits (171), Expect = 8.7e-13 Identity = 33/39 (84.62%), Postives = 34/39 (87.18%), Query Frame = 1
HSP 2 Score: 33.1 bits (74), Expect = 1.5e-01 Identity = 17/30 (56.67%), Postives = 18/30 (60.00%), Query Frame = 3
BLAST of WMU11266 vs. TAIR10
Match: AT5G55850.2 (AT5G55850.2 RPM1-interacting protein 4 (RIN4) family protein) HSP 1 Score: 66.6 bits (161), Expect = 1.3e-11 Identity = 29/31 (93.55%), Postives = 29/31 (93.55%), Query Frame = 1
BLAST of WMU11266 vs. TAIR10
Match: AT4G35655.1 (AT4G35655.1 RPM1-interacting protein 4 (RIN4) family protein) HSP 1 Score: 62.8 bits (151), Expect = 1.8e-10 Identity = 27/39 (69.23%), Postives = 30/39 (76.92%), Query Frame = 1
BLAST of WMU11266 vs. TAIR10
Match: AT5G40645.1 (AT5G40645.1 RPM1-interacting protein 4 (RIN4) family protein) HSP 1 Score: 62.4 bits (150), Expect = 2.4e-10 Identity = 27/31 (87.10%), Postives = 28/31 (90.32%), Query Frame = 1
BLAST of WMU11266 vs. TAIR10
Match: AT5G63270.1 (AT5G63270.1 RPM1-interacting protein 4 (RIN4) family protein) HSP 1 Score: 61.2 bits (147), Expect = 5.3e-10 Identity = 29/39 (74.36%), Postives = 31/39 (79.49%), Query Frame = 1
BLAST of WMU11266 vs. TrEMBL
Match: A0A0A0KCQ1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G113510 PE=4 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 3.4e-13 Identity = 38/39 (97.44%), Postives = 39/39 (100.00%), Query Frame = 1
BLAST of WMU11266 vs. TrEMBL
Match: A0A0A0KCQ1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G113510 PE=4 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 1.1e-05 Identity = 29/42 (69.05%), Postives = 33/42 (78.57%), Query Frame = 3
HSP 2 Score: 73.2 bits (178), Expect = 2.7e-10 Identity = 35/39 (89.74%), Postives = 36/39 (92.31%), Query Frame = 1
BLAST of WMU11266 vs. TrEMBL
Match: A0A067E6W9_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g040492mg PE=4 SV=1) HSP 1 Score: 43.9 bits (102), Expect = 1.7e-01 Identity = 21/47 (44.68%), Postives = 29/47 (61.70%), Query Frame = 3
HSP 2 Score: 73.2 bits (178), Expect = 2.7e-10 Identity = 35/39 (89.74%), Postives = 36/39 (92.31%), Query Frame = 1
BLAST of WMU11266 vs. TrEMBL
Match: V4UFJ1_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10018013mg PE=4 SV=1) HSP 1 Score: 43.9 bits (102), Expect = 1.7e-01 Identity = 21/47 (44.68%), Postives = 29/47 (61.70%), Query Frame = 3
HSP 2 Score: 73.2 bits (178), Expect = 2.7e-10 Identity = 35/39 (89.74%), Postives = 36/39 (92.31%), Query Frame = 1
BLAST of WMU11266 vs. TrEMBL
Match: A0A067K144_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_18520 PE=4 SV=1) HSP 1 Score: 37.0 bits (84), Expect = 2.1e+01 Identity = 18/35 (51.43%), Postives = 24/35 (68.57%), Query Frame = 3
HSP 2 Score: 72.4 bits (176), Expect = 4.5e-10 Identity = 32/42 (76.19%), Postives = 38/42 (90.48%), Query Frame = 1
BLAST of WMU11266 vs. NCBI nr
Match: gi|659128325|ref|XP_008464154.1| (PREDICTED: RPM1-interacting protein 4-like isoform X2 [Cucumis melo]) HSP 1 Score: 83.6 bits (205), Expect = 2.8e-13 Identity = 38/39 (97.44%), Postives = 39/39 (100.00%), Query Frame = 1
BLAST of WMU11266 vs. NCBI nr
Match: gi|659128323|ref|XP_008464153.1| (PREDICTED: RPM1-interacting protein 4-like isoform X1 [Cucumis melo]) HSP 1 Score: 80.1 bits (196), Expect = 3.1e-12 Identity = 36/37 (97.30%), Postives = 37/37 (100.00%), Query Frame = 1
BLAST of WMU11266 vs. NCBI nr
Match: gi|747076664|ref|XP_011085412.1| (PREDICTED: RPM1-interacting protein 4 isoform X2 [Sesamum indicum]) HSP 1 Score: 74.3 bits (181), Expect = 1.7e-10 Identity = 36/39 (92.31%), Postives = 36/39 (92.31%), Query Frame = 1
BLAST of WMU11266 vs. NCBI nr
Match: gi|747076662|ref|XP_011085411.1| (PREDICTED: RPM1-interacting protein 4 isoform X1 [Sesamum indicum]) HSP 1 Score: 74.3 bits (181), Expect = 1.7e-10 Identity = 36/39 (92.31%), Postives = 36/39 (92.31%), Query Frame = 1
BLAST of WMU11266 vs. NCBI nr
Match: gi|643718852|gb|KDP29951.1| (hypothetical protein JCGZ_18520 [Jatropha curcas]) HSP 1 Score: 73.9 bits (180), Expect = 2.2e-10 Identity = 35/39 (89.74%), Postives = 36/39 (92.31%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|