WMU08787 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GAGATAAGAATTAAAGTATTTTGTTAGAAAGGATTGCTCGGTGATTTGATTTGGGAAGAAGTGGCAACTTTATTTAGCTCTTGATTGATCCATCAAGGATTTGTATCCCTTTTGGTCTCATCTCTTTCCTTTCACCTACTTTTGCAACTAACTTCCTGCATCGTTGGCCCGTATAAGCAACAGCTAGTGTGTGACTTCTAGATTGAATTACATCCGGGATGTCTTGAATCAAGGCTGCTGGCTTTTCGGCTTTTGGCATTTTGCTTCAAGAGGTCAGAAACAGAAGCACAATGTGTTGATTTGTAATCGCAGTTCTCACAGCAATATTGCAATAGTTGAATGACCCTGACGCACTTGTGAGGAAGAAAAGTTGTTTTTGGAGAGACAAGCTTGAATGTCGCACGCCTCTTTCTTGCAGGGGTTCTTTGCTCGGCGGAGGCATTTCTCTCTCTCCCGCGATGTCC
BLAST of WMU08787 vs. TAIR10
Match: AT1G09794.1 (AT1G09794.1 Cox19 family protein (CHCH motif)) HSP 1 Score: 61.6 bits (148), Expect = 4.8e-10 Identity = 27/58 (46.55%), Postives = 35/58 (60.34%), Query Frame = -1
BLAST of WMU08787 vs. TrEMBL
Match: A0A0A0LC41_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G228340 PE=4 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 2.3e-13 Identity = 37/55 (67.27%), Postives = 41/55 (74.55%), Query Frame = -1
BLAST of WMU08787 vs. TrEMBL
Match: S8D116_9LAMI (Uncharacterized protein (Fragment) OS=Genlisea aurea GN=M569_01308 PE=4 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 6.4e-11 Identity = 36/59 (61.02%), Postives = 42/59 (71.19%), Query Frame = -1
BLAST of WMU08787 vs. TrEMBL
Match: A0A072UUM7_MEDTR (Cox19 family protein (CHCH motif) OS=Medicago truncatula GN=MTR_4g134900 PE=4 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 1.1e-10 Identity = 32/65 (49.23%), Postives = 42/65 (64.62%), Query Frame = -1
BLAST of WMU08787 vs. TrEMBL
Match: A0A022QEZ0_ERYGU (Uncharacterized protein OS=Erythranthe guttata GN=MIMGU_mgv1a017584mg PE=4 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 1.9e-10 Identity = 31/55 (56.36%), Postives = 39/55 (70.91%), Query Frame = -1
BLAST of WMU08787 vs. TrEMBL
Match: D7TGV7_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_12s0035g00710 PE=4 SV=1) HSP 1 Score: 72.8 bits (177), Expect = 4.1e-10 Identity = 32/60 (53.33%), Postives = 38/60 (63.33%), Query Frame = -1
BLAST of WMU08787 vs. NCBI nr
Match: gi|449457033|ref|XP_004146253.1| (PREDICTED: cx9C motif-containing protein 4 [Cucumis sativus]) HSP 1 Score: 80.9 bits (198), Expect = 2.2e-12 Identity = 37/55 (67.27%), Postives = 41/55 (74.55%), Query Frame = -1
BLAST of WMU08787 vs. NCBI nr
Match: gi|659112052|ref|XP_008456041.1| (PREDICTED: cx9C motif-containing protein 4 [Cucumis melo]) HSP 1 Score: 80.9 bits (198), Expect = 2.2e-12 Identity = 40/63 (63.49%), Postives = 46/63 (73.02%), Query Frame = -1
BLAST of WMU08787 vs. NCBI nr
Match: gi|527208473|gb|EPS73449.1| (hypothetical protein M569_01308, partial [Genlisea aurea]) HSP 1 Score: 72.4 bits (176), Expect = 7.8e-10 Identity = 36/59 (61.02%), Postives = 42/59 (71.19%), Query Frame = -1
BLAST of WMU08787 vs. NCBI nr
Match: gi|747080868|ref|XP_011087700.1| (PREDICTED: cx9C motif-containing protein 4 [Sesamum indicum]) HSP 1 Score: 71.6 bits (174), Expect = 1.3e-09 Identity = 33/55 (60.00%), Postives = 39/55 (70.91%), Query Frame = -1
BLAST of WMU08787 vs. NCBI nr
Match: gi|848900407|ref|XP_012850363.1| (PREDICTED: cx9C motif-containing protein 4 [Erythranthe guttata]) HSP 1 Score: 71.2 bits (173), Expect = 1.7e-09 Identity = 31/55 (56.36%), Postives = 39/55 (70.91%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|