WMU06374 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
AGAGGACAAGTGGATTTAGCAATGAGTACATTGTGATAACAATATTGGTGGCTGCTGAGGGAGTTCATAAGCTGCCCACTATCAATGGCAGCAGGGACTTGAAGGAAGCTTTGCAGAAACTTGCATCCATCCCTTCCAGCAAAATATTGGCTGTTGAAGTTTTGTGGACACCACAGAATGAGAACGACACATTGTCTGAACGCGAACTCCTCGAAGATTACCCACTTTTAAGGCCTTTATAAGTACGTGCAAAAAAAGTAATTTTTACCATGCTTTACCGATTACATATAGATATAATGATTAGAATATAGAGCTGTCTTGACTTAGAAAATAGTGTATATAATAACATAATTACAAATTTAAGTTTTCATTTGGTTTTTCTATTCATTTATTTTGGTGGAC
BLAST of WMU06374 vs. TAIR10
Match: AT1G54520.1 (AT1G54520.1 unknown protein) HSP 1 Score: 132.1 bits (331), Expect = 2.5e-31 Identity = 64/79 (81.01%), Postives = 70/79 (88.61%), Query Frame = 3
BLAST of WMU06374 vs. TrEMBL
Match: A0A0A0LY57_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G695400 PE=4 SV=1) HSP 1 Score: 153.3 bits (386), Expect = 2.1e-34 Identity = 78/79 (98.73%), Postives = 78/79 (98.73%), Query Frame = 3
BLAST of WMU06374 vs. TrEMBL
Match: V4V360_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10001390mg PE=4 SV=1) HSP 1 Score: 148.7 bits (374), Expect = 5.1e-33 Identity = 74/79 (93.67%), Postives = 77/79 (97.47%), Query Frame = 3
BLAST of WMU06374 vs. TrEMBL
Match: A0A061F284_THECC (Myelin-associated oligodendrocyte basic protein isoform 1 OS=Theobroma cacao GN=TCM_026403 PE=4 SV=1) HSP 1 Score: 148.3 bits (373), Expect = 6.7e-33 Identity = 74/79 (93.67%), Postives = 77/79 (97.47%), Query Frame = 3
BLAST of WMU06374 vs. TrEMBL
Match: A0A061F388_THECC (Myelin-associated oligodendrocyte basic protein isoform 2 OS=Theobroma cacao GN=TCM_026403 PE=4 SV=1) HSP 1 Score: 148.3 bits (373), Expect = 6.7e-33 Identity = 74/79 (93.67%), Postives = 77/79 (97.47%), Query Frame = 3
BLAST of WMU06374 vs. TrEMBL
Match: A0A059B7L1_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_H04386 PE=4 SV=1) HSP 1 Score: 147.1 bits (370), Expect = 1.5e-32 Identity = 74/79 (93.67%), Postives = 76/79 (96.20%), Query Frame = 3
BLAST of WMU06374 vs. NCBI nr
Match: gi|700211709|gb|KGN66805.1| (hypothetical protein Csa_1G695400 [Cucumis sativus]) HSP 1 Score: 154.5 bits (389), Expect = 1.3e-34 Identity = 78/79 (98.73%), Postives = 78/79 (98.73%), Query Frame = 3
BLAST of WMU06374 vs. NCBI nr
Match: gi|659125607|ref|XP_008462772.1| (PREDICTED: uncharacterized protein LOC103501059, partial [Cucumis melo]) HSP 1 Score: 154.5 bits (389), Expect = 1.3e-34 Identity = 78/79 (98.73%), Postives = 78/79 (98.73%), Query Frame = 3
BLAST of WMU06374 vs. NCBI nr
Match: gi|449449537|ref|XP_004142521.1| (PREDICTED: uncharacterized protein LOC101210275 [Cucumis sativus]) HSP 1 Score: 154.5 bits (389), Expect = 1.3e-34 Identity = 78/79 (98.73%), Postives = 78/79 (98.73%), Query Frame = 3
BLAST of WMU06374 vs. NCBI nr
Match: gi|567880971|ref|XP_006433044.1| (hypothetical protein CICLE_v10001390mg [Citrus clementina]) HSP 1 Score: 149.8 bits (377), Expect = 3.3e-33 Identity = 74/79 (93.67%), Postives = 77/79 (97.47%), Query Frame = 3
BLAST of WMU06374 vs. NCBI nr
Match: gi|590642849|ref|XP_007030634.1| (Myelin-associated oligodendrocyte basic protein isoform 1 [Theobroma cacao]) HSP 1 Score: 149.4 bits (376), Expect = 4.3e-33 Identity = 74/79 (93.67%), Postives = 77/79 (97.47%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|