WMU06305 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
GGAGGAGTTTTAATGTCACATTTGGAAGGCAAAGCCAAAGCATTGGTTATATTAATCCCAATGGATGGGAGGATTGATTTGAAGTTGCACAAACACTTGAGATCGGCACGACGAAGCACCGAACAACAACCTTTAGTTGGTGGTTGCAATGGTTTTCCATGCCAAGGAGCCACTGCTGGTTGACACACACCAGGCTCCTTCGTGTCAATCTTACACAAAGGGTTGGTGCTAGTACCTGCCAGAAGCATGGCTAAGAGTAACAATCTTAAAAATAATGGCACCAAAAACTTGTTAGTTGTCATCAACATTGTTCACAAAAAAATAAAATAAAATTAGAAATTAAGTATAAGTTTGAAGTCATGATCAAAAGATGGTGGGC
BLAST of WMU06305 vs. TAIR10
Match: AT5G55450.1 (AT5G55450.1 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein) HSP 1 Score: 62.8 bits (151), Expect = 1.8e-10 Identity = 29/76 (38.16%), Postives = 44/76 (57.89%), Query Frame = -3
BLAST of WMU06305 vs. TAIR10
Match: AT5G55410.2 (AT5G55410.2 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein) HSP 1 Score: 58.2 bits (139), Expect = 4.3e-09 Identity = 26/71 (36.62%), Postives = 39/71 (54.93%), Query Frame = -3
BLAST of WMU06305 vs. TAIR10
Match: AT5G55460.1 (AT5G55460.1 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein) HSP 1 Score: 56.6 bits (135), Expect = 1.3e-08 Identity = 28/70 (40.00%), Postives = 37/70 (52.86%), Query Frame = -3
BLAST of WMU06305 vs. TrEMBL
Match: A0A0A0LBB0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G759990 PE=4 SV=1) HSP 1 Score: 126.3 bits (316), Expect = 2.6e-26 Identity = 63/102 (61.76%), Postives = 70/102 (68.63%), Query Frame = -3
BLAST of WMU06305 vs. TrEMBL
Match: A0A0A0LAS6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G760500 PE=4 SV=1) HSP 1 Score: 104.0 bits (258), Expect = 1.4e-19 Identity = 48/80 (60.00%), Postives = 61/80 (76.25%), Query Frame = -3
BLAST of WMU06305 vs. TrEMBL
Match: K7MTB4_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_18G191800 PE=4 SV=1) HSP 1 Score: 82.0 bits (201), Expect = 5.5e-13 Identity = 37/78 (47.44%), Postives = 54/78 (69.23%), Query Frame = -3
BLAST of WMU06305 vs. TrEMBL
Match: C6T4Z3_SOYBN (Putative uncharacterized protein OS=Glycine max PE=2 SV=1) HSP 1 Score: 82.0 bits (201), Expect = 5.5e-13 Identity = 37/78 (47.44%), Postives = 54/78 (69.23%), Query Frame = -3
BLAST of WMU06305 vs. TrEMBL
Match: A0A0B2Q3M5_GLYSO (Putative lipid-transfer protein DIR1 OS=Glycine soja GN=glysoja_037560 PE=4 SV=1) HSP 1 Score: 82.0 bits (201), Expect = 5.5e-13 Identity = 37/78 (47.44%), Postives = 54/78 (69.23%), Query Frame = -3
BLAST of WMU06305 vs. NCBI nr
Match: gi|659093748|ref|XP_008447696.1| (PREDICTED: putative lipid-transfer protein DIR1 [Cucumis melo]) HSP 1 Score: 136.0 bits (341), Expect = 4.6e-29 Identity = 67/102 (65.69%), Postives = 72/102 (70.59%), Query Frame = -3
BLAST of WMU06305 vs. NCBI nr
Match: gi|700203945|gb|KGN59078.1| (hypothetical protein Csa_3G759990 [Cucumis sativus]) HSP 1 Score: 127.1 bits (318), Expect = 2.2e-26 Identity = 63/102 (61.76%), Postives = 70/102 (68.63%), Query Frame = -3
BLAST of WMU06305 vs. NCBI nr
Match: gi|449465073|ref|XP_004150253.1| (PREDICTED: putative lipid-transfer protein DIR1 [Cucumis sativus]) HSP 1 Score: 104.4 bits (259), Expect = 1.5e-19 Identity = 48/80 (60.00%), Postives = 61/80 (76.25%), Query Frame = -3
BLAST of WMU06305 vs. NCBI nr
Match: gi|659093746|ref|XP_008447695.1| (PREDICTED: putative lipid-transfer protein DIR1 [Cucumis melo]) HSP 1 Score: 100.9 bits (250), Expect = 1.7e-18 Identity = 48/77 (62.34%), Postives = 57/77 (74.03%), Query Frame = -3
BLAST of WMU06305 vs. NCBI nr
Match: gi|694376285|ref|XP_009364632.1| (PREDICTED: putative lipid-transfer protein DIR1, partial [Pyrus x bretschneideri]) HSP 1 Score: 91.3 bits (225), Expect = 1.3e-15 Identity = 43/79 (54.43%), Postives = 58/79 (73.42%), Query Frame = -3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|