WMU05460 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
ATTCCCACACAACGTGGTGTTCGATGAGGACGAAATCCCGAGCGGAGTGGACGCGGGAAAGATCTCGATGAGTGAGGAAGATCTTCTGAATGCTCCCGGCCAGGTGTACGAAGTCCAGCTAACTGAAAAAGGAAGCTACTCTTTCTACTGTTCGCCCCATCAAGGAGCTGGAATGGTCGGAAAGGGTCACCGTTAACTGATCCATTCATTAATTCCTCCTCTTCCAATTTTTTCCCCTGTAATGTTCATCTTTTTTTTTTAATATATATAATAAATTAAAGTGAT
BLAST of WMU05460 vs. TAIR10
Match: AT1G20340.1 (AT1G20340.1 Cupredoxin superfamily protein) HSP 1 Score: 107.8 bits (268), Expect = 3.6e-24 Identity = 48/61 (78.69%), Postives = 51/61 (83.61%), Query Frame = 2
BLAST of WMU05460 vs. TAIR10
Match: AT1G76100.1 (AT1G76100.1 plastocyanin 1) HSP 1 Score: 105.9 bits (263), Expect = 1.4e-23 Identity = 49/61 (80.33%), Postives = 49/61 (80.33%), Query Frame = 2
BLAST of WMU05460 vs. Swiss-Prot
Match: PLAS_CUCSA (Plastocyanin OS=Cucumis sativus GN=PETE PE=1 SV=1) HSP 1 Score: 125.2 bits (313), Expect = 3.9e-28 Identity = 54/61 (88.52%), Postives = 59/61 (96.72%), Query Frame = 2
BLAST of WMU05460 vs. Swiss-Prot
Match: PLAS_CUCPE (Plastocyanin OS=Cucurbita pepo GN=PETE PE=1 SV=1) HSP 1 Score: 124.0 bits (310), Expect = 8.6e-28 Identity = 57/61 (93.44%), Postives = 58/61 (95.08%), Query Frame = 2
BLAST of WMU05460 vs. Swiss-Prot
Match: PLAS_SPIOL (Plastocyanin, chloroplastic OS=Spinacia oleracea GN=PETE PE=1 SV=2) HSP 1 Score: 118.2 bits (295), Expect = 4.7e-26 Identity = 54/61 (88.52%), Postives = 55/61 (90.16%), Query Frame = 2
BLAST of WMU05460 vs. Swiss-Prot
Match: PLAS_LACSA (Plastocyanin OS=Lactuca sativa GN=PETE PE=1 SV=1) HSP 1 Score: 116.7 bits (291), Expect = 1.4e-25 Identity = 53/61 (86.89%), Postives = 55/61 (90.16%), Query Frame = 2
BLAST of WMU05460 vs. Swiss-Prot
Match: PLAS_MERPE (Plastocyanin OS=Mercurialis perennis GN=PETE PE=1 SV=1) HSP 1 Score: 116.3 bits (290), Expect = 1.8e-25 Identity = 54/61 (88.52%), Postives = 53/61 (86.89%), Query Frame = 2
BLAST of WMU05460 vs. TrEMBL
Match: A0A0A0LE99_CUCSA (Plastocyanin OS=Cucumis sativus GN=Csa_3G875430 PE=3 SV=1) HSP 1 Score: 123.6 bits (309), Expect = 1.2e-25 Identity = 57/61 (93.44%), Postives = 59/61 (96.72%), Query Frame = 2
BLAST of WMU05460 vs. TrEMBL
Match: E0CQV6_VITVI (Plastocyanin OS=Vitis vinifera GN=VIT_18s0001g00760 PE=3 SV=1) HSP 1 Score: 119.0 bits (297), Expect = 3.1e-24 Identity = 54/61 (88.52%), Postives = 57/61 (93.44%), Query Frame = 2
BLAST of WMU05460 vs. TrEMBL
Match: A5ALX7_VITVI (Plastocyanin OS=Vitis vinifera GN=VITISV_038998 PE=3 SV=1) HSP 1 Score: 119.0 bits (297), Expect = 3.1e-24 Identity = 54/61 (88.52%), Postives = 57/61 (93.44%), Query Frame = 2
BLAST of WMU05460 vs. TrEMBL
Match: A0A0V0RCP2_9BILA (Plastocyanin (Fragment) OS=Trichinella nelsoni GN=PETE PE=4 SV=1) HSP 1 Score: 118.6 bits (296), Expect = 4.0e-24 Identity = 54/61 (88.52%), Postives = 56/61 (91.80%), Query Frame = 2
BLAST of WMU05460 vs. TrEMBL
Match: M5XH36_PRUPE (Plastocyanin OS=Prunus persica GN=PRUPE_ppa012521mg PE=3 SV=1) HSP 1 Score: 118.6 bits (296), Expect = 4.0e-24 Identity = 52/61 (85.25%), Postives = 57/61 (93.44%), Query Frame = 2
BLAST of WMU05460 vs. NCBI nr
Match: gi|130266|sp|P00293.1|PLAS_CUCSA (RecName: Full=Plastocyanin) HSP 1 Score: 125.2 bits (313), Expect = 6.2e-26 Identity = 54/61 (88.52%), Postives = 61/61 (100.00%), Query Frame = 2
BLAST of WMU05460 vs. NCBI nr
Match: gi|659132911|ref|XP_008466451.1| (PREDICTED: plastocyanin [Cucumis melo]) HSP 1 Score: 125.2 bits (313), Expect = 6.2e-26 Identity = 58/61 (95.08%), Postives = 60/61 (98.36%), Query Frame = 2
BLAST of WMU05460 vs. NCBI nr
Match: gi|130265|sp|P00292.1|PLAS_CUCPE (RecName: Full=Plastocyanin) HSP 1 Score: 124.0 bits (310), Expect = 1.4e-25 Identity = 57/61 (93.44%), Postives = 60/61 (98.36%), Query Frame = 2
BLAST of WMU05460 vs. NCBI nr
Match: gi|449437172|ref|XP_004136366.1| (PREDICTED: plastocyanin [Cucumis sativus]) HSP 1 Score: 123.6 bits (309), Expect = 1.8e-25 Identity = 57/61 (93.44%), Postives = 59/61 (96.72%), Query Frame = 2
BLAST of WMU05460 vs. NCBI nr
Match: gi|694316574|ref|XP_009334523.1| (PREDICTED: plastocyanin [Pyrus x bretschneideri]) HSP 1 Score: 121.7 bits (304), Expect = 6.8e-25 Identity = 55/61 (90.16%), Postives = 58/61 (95.08%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|