WMU05048 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
TGAAGAAGGGACTTTGTTGGCCCTAGAAGCGGTCAGACGGCGGCGCATTGATCGGAGAGAAAATGGAGAAGGCCCTGAGAATATACGGCGAAGTTTTGAGGTTAGTCCGGCGGTTACCAAAGGATACGAGGCCTTACTACGCCAAGTACGCTCGAGAGAATTTCGTCAACTACAGAGAAGTCGATGCCAACGATGCCAAAATCCCTAGAAGAACTCTTCCACAGAGCTTATAACCACTCCGTTTGGGTTCTGAACAAGTATTCGGTGGATGGATCTGCGGCGGATAAGCTGAAGGAGATCTGTTATAATTAATGTAAGGACCCGCGTCGGATTTTTACAGTTGAAACTCCGGCGGTGGCGGGCATGAATTCTGATGAATTCAATAGAGGTAGGGAATTGGAGGATTATGGATTTAAAAAGAAAGTATTAGATACAATCATCATTCTGTTTTTCTGTTATATAATGTAATTTTGTTATTTAC
BLAST of WMU05048 vs. TAIR10
Match: AT3G19508.1 (AT3G19508.1 unknown protein) HSP 1 Score: 74.7 bits (182), Expect = 5.7e-14 Identity = 33/47 (70.21%), Postives = 38/47 (80.85%), Query Frame = 3
HSP 2 Score: 61.6 bits (148), Expect = 5.0e-10 Identity = 27/35 (77.14%), Postives = 29/35 (82.86%), Query Frame = 1
BLAST of WMU05048 vs. Swiss-Prot
Match: LYRM9_ARATH (LYR motif-containing protein At3g19508 OS=Arabidopsis thaliana GN=At3g19508 PE=3 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 1.0e-12 Identity = 33/47 (70.21%), Postives = 38/47 (80.85%), Query Frame = 3
HSP 2 Score: 61.6 bits (148), Expect = 8.9e-09 Identity = 27/35 (77.14%), Postives = 29/35 (82.86%), Query Frame = 1
BLAST of WMU05048 vs. TrEMBL
Match: A0A0A0L970_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G199560 PE=3 SV=1) HSP 1 Score: 90.5 bits (223), Expect = 2.0e-15 Identity = 42/46 (91.30%), Postives = 44/46 (95.65%), Query Frame = 3
BLAST of WMU05048 vs. TrEMBL
Match: A0A0A0L970_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G199560 PE=3 SV=1) HSP 1 Score: 77.8 bits (190), Expect = 1.3e-11 Identity = 35/36 (97.22%), Postives = 36/36 (100.00%), Query Frame = 1
HSP 2 Score: 87.0 bits (214), Expect = 2.2e-14 Identity = 39/44 (88.64%), Postives = 44/44 (100.00%), Query Frame = 3
BLAST of WMU05048 vs. TrEMBL
Match: A0A067LB24_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_16266 PE=3 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 9.9e-07 Identity = 28/34 (82.35%), Postives = 32/34 (94.12%), Query Frame = 1
HSP 2 Score: 86.7 bits (213), Expect = 2.9e-14 Identity = 39/46 (84.78%), Postives = 45/46 (97.83%), Query Frame = 3
BLAST of WMU05048 vs. TrEMBL
Match: A0A061E024_THECC (UPF0631 protein OS=Theobroma cacao GN=TCM_007162 PE=3 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 1.5e-07 Identity = 28/35 (80.00%), Postives = 32/35 (91.43%), Query Frame = 1
HSP 2 Score: 86.3 bits (212), Expect = 3.7e-14 Identity = 40/45 (88.89%), Postives = 42/45 (93.33%), Query Frame = 3
BLAST of WMU05048 vs. TrEMBL
Match: V4SGL4_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10029710mg PE=3 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 6.9e-08 Identity = 28/34 (82.35%), Postives = 32/34 (94.12%), Query Frame = 1
HSP 2 Score: 86.3 bits (212), Expect = 3.7e-14 Identity = 39/44 (88.64%), Postives = 43/44 (97.73%), Query Frame = 3
BLAST of WMU05048 vs. NCBI nr
Match: gi|659112342|ref|XP_008456173.1| (PREDICTED: LYR motif-containing protein At3g19508 [Cucumis melo]) HSP 1 Score: 96.3 bits (238), Expect = 5.2e-17 Identity = 45/46 (97.83%), Postives = 46/46 (100.00%), Query Frame = 3
BLAST of WMU05048 vs. NCBI nr
Match: gi|1009150076|ref|XP_015892821.1| (PREDICTED: LYR motif-containing protein At3g19508 [Ziziphus jujuba]) HSP 1 Score: 93.2 bits (230), Expect = 4.4e-16 Identity = 43/45 (95.56%), Postives = 45/45 (100.00%), Query Frame = 3
BLAST of WMU05048 vs. NCBI nr
Match: gi|449445916|ref|XP_004140718.1| (PREDICTED: LYR motif-containing protein At3g19508 [Cucumis sativus]) HSP 1 Score: 90.9 bits (224), Expect = 2.2e-15 Identity = 42/46 (91.30%), Postives = 44/46 (95.65%), Query Frame = 3
BLAST of WMU05048 vs. NCBI nr
Match: gi|657977358|ref|XP_008380588.1| (PREDICTED: LYR motif-containing protein At3g19508 [Malus domestica]) HSP 1 Score: 88.6 bits (218), Expect = 1.1e-14 Identity = 41/46 (89.13%), Postives = 45/46 (97.83%), Query Frame = 3
BLAST of WMU05048 vs. NCBI nr
Match: gi|802550567|ref|XP_012092964.1| (PREDICTED: LYR motif-containing protein At3g19508 [Jatropha curcas]) HSP 1 Score: 87.4 bits (215), Expect = 2.4e-14 Identity = 39/44 (88.64%), Postives = 44/44 (100.00%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|