WMU04737 (transcribed_cluster) Watermelon (97103) v1
The following sequences are available for this feature:
CCTTGATGTATACCGCAACCTGCTTTCAAAGTTGGTTCAAGCGAAGGAGCTCCTAAAGGAATACGTCGATAGAGAGAAGAAGAAAAGAGATGAGAGGAGTGGATCACAGACAGCTAATGAGGCCATAACTAAATGCTTGGGAGAATACAGCATGCAGACTGGTTTGTAAAGAAAAGATGATTGGAGCACTTCCTAATTTGAGATAGACTTGAGAGTTTATAGCAATATTCTAAATTACCCTATAGATATGCATCTGTAATGAATTGTTGGGTCTCATGCATTTGGTAAATTTTGTATTCAGCCAGGCACTACCTTTATTTCTCATTTGATATAACCACCACTCAAGCTATTTTTAATCATTTGTATTACATATTTTAGAGCGCAATTGTTAATACAAATGCTATCGCACTCTGTGCAGTAATCACTCTCCAAGTGATATTTGACATAAAAAAAAA
BLAST of WMU04737 vs. TAIR10
Match: AT2G20890.1 (AT2G20890.1 photosystem II reaction center PSB29 protein) HSP 1 Score: 79.7 bits (195), Expect = 1.7e-15 Identity = 39/48 (81.25%), Postives = 42/48 (87.50%), Query Frame = 2
BLAST of WMU04737 vs. Swiss-Prot
Match: THF1_SOLTU (Protein THYLAKOID FORMATION1, chloroplastic OS=Solanum tuberosum GN=THF1 PE=2 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 3.0e-14 Identity = 40/49 (81.63%), Postives = 42/49 (85.71%), Query Frame = 2
BLAST of WMU04737 vs. Swiss-Prot
Match: THF1_ARATH (Protein THYLAKOID FORMATION 1, chloroplastic OS=Arabidopsis thaliana GN=THF1 PE=1 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 3.0e-14 Identity = 39/48 (81.25%), Postives = 42/48 (87.50%), Query Frame = 2
BLAST of WMU04737 vs. Swiss-Prot
Match: THF1_ORYSJ (Protein THYLAKOID FORMATION1, chloroplastic OS=Oryza sativa subsp. japonica GN=THF1 PE=2 SV=1) HSP 1 Score: 72.8 bits (177), Expect = 3.6e-12 Identity = 35/44 (79.55%), Postives = 39/44 (88.64%), Query Frame = 2
BLAST of WMU04737 vs. TrEMBL
Match: A0A0A0K3P0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G046130 PE=3 SV=1) HSP 1 Score: 109.0 bits (271), Expect = 5.1e-21 Identity = 54/55 (98.18%), Postives = 55/55 (100.00%), Query Frame = 2
BLAST of WMU04737 vs. TrEMBL
Match: M0TZM8_MUSAM (Uncharacterized protein OS=Musa acuminata subsp. malaccensis PE=3 SV=1) HSP 1 Score: 89.7 bits (221), Expect = 3.2e-15 Identity = 44/53 (83.02%), Postives = 48/53 (90.57%), Query Frame = 2
BLAST of WMU04737 vs. TrEMBL
Match: A0A059DG08_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_A01774 PE=3 SV=1) HSP 1 Score: 89.4 bits (220), Expect = 4.2e-15 Identity = 44/49 (89.80%), Postives = 46/49 (93.88%), Query Frame = 2
BLAST of WMU04737 vs. TrEMBL
Match: F6HHI1_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_12s0057g00020 PE=3 SV=1) HSP 1 Score: 88.6 bits (218), Expect = 7.2e-15 Identity = 44/49 (89.80%), Postives = 46/49 (93.88%), Query Frame = 2
BLAST of WMU04737 vs. TrEMBL
Match: V7BZ23_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_005G108600g PE=3 SV=1) HSP 1 Score: 87.8 bits (216), Expect = 1.2e-14 Identity = 44/48 (91.67%), Postives = 45/48 (93.75%), Query Frame = 2
BLAST of WMU04737 vs. NCBI nr
Match: gi|449438054|ref|XP_004136805.1| (PREDICTED: protein THYLAKOID FORMATION1, chloroplastic [Cucumis sativus]) HSP 1 Score: 106.3 bits (264), Expect = 4.8e-20 Identity = 54/55 (98.18%), Postives = 55/55 (100.00%), Query Frame = 2
BLAST of WMU04737 vs. NCBI nr
Match: gi|659110691|ref|XP_008455361.1| (PREDICTED: protein THYLAKOID FORMATION1, chloroplastic [Cucumis melo]) HSP 1 Score: 105.9 bits (263), Expect = 6.2e-20 Identity = 53/55 (96.36%), Postives = 55/55 (100.00%), Query Frame = 2
BLAST of WMU04737 vs. NCBI nr
Match: gi|695057951|ref|XP_009417272.1| (PREDICTED: protein THYLAKOID FORMATION1, chloroplastic-like [Musa acuminata subsp. malaccensis]) HSP 1 Score: 86.7 bits (213), Expect = 3.9e-14 Identity = 44/53 (83.02%), Postives = 48/53 (90.57%), Query Frame = 2
BLAST of WMU04737 vs. NCBI nr
Match: gi|702244538|ref|XP_010051514.1| (PREDICTED: protein THYLAKOID FORMATION1, chloroplastic [Eucalyptus grandis]) HSP 1 Score: 86.3 bits (212), Expect = 5.1e-14 Identity = 44/49 (89.80%), Postives = 46/49 (93.88%), Query Frame = 2
BLAST of WMU04737 vs. NCBI nr
Match: gi|720041318|ref|XP_010268869.1| (PREDICTED: protein THYLAKOID FORMATION1, chloroplastic-like [Nelumbo nucifera]) HSP 1 Score: 85.9 bits (211), Expect = 6.7e-14 Identity = 43/49 (87.76%), Postives = 47/49 (95.92%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of watermelon unigene v2
Date Performed: 2016-11-16
|