MU61344 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
GCGGAGGAGAAAATTGATCGATAGGCAAAAAGAAGTGAGAAAATGGCAGCTTCTTCGTCTTCCTTTTTCGCCGCCGCTTCTCAGAAGGCCGGACCAGCCGTTCGCCGCCAAATTCTTACTCTCACGGAGGCAGCCGCCGCTAGAATTCGACAACTTCTTCAACAGCGCCAACGTCCATTCCTTCGTCTTGGCGTCAAGGCGCGCGGTTGTAATGGTTTATCCTATACTCTCAACTACGCAGATGAGAAAGGGAAGTTTGATGAGCTGGTTGAGGATCAAAATGTGAAAATACTGATCGATCCAAAGGCTCTAATGCACGTAATAGGAACAAAAATGGACTTTGTCGATGACAAATTAAGGTCAATGTGGCTGTTGGGAGTCCTTTATGACAACAAGTAGTGCAGAAGCCAACAAAAAATGAGGCAGTTCGAGCAATGAGCGTTGTTTTTAAGAACTCAAAACTCACAGTTGCTGATTTGTTGTGTATTTTGCTGGAATTACAAGCACAATGATCAAGAGAGTTCTCTGACAACAACTTTAAACATTTGTAAGAATATTTCTATATTGGCTGATTATATTCTTAGAAAGTCAGTTAAGAGTTGTACTCTGCTAATTTTTTTTCTTTAAAAATATTTTGTATGTATATTACTGTAGATTAAACTGGCTAATGAGTTATATATGAGAGCCTATAAGGTAATAAAATTCGCCCACGACTTTCTTTTTGTTAG
BLAST of MU61344 vs. Swiss-Prot
Match: ISAM1_ARATH (Iron-sulfur assembly protein IscA-like 1, mitochondrial OS=Arabidopsis thaliana GN=At2g16710 PE=2 SV=2) HSP 1 Score: 125.6 bits (314), Expect = 7.6e-28 Identity = 61/93 (65.59%), Postives = 69/93 (74.19%), Query Frame = 1
HSP 2 Score: 33.1 bits (74), Expect = 5.1e+00 Identity = 13/19 (68.42%), Postives = 14/19 (73.68%), Query Frame = 2
BLAST of MU61344 vs. Swiss-Prot
Match: ISAM3_ARATH (Iron-sulfur assembly protein IscA-like 3, mitochondrial OS=Arabidopsis thaliana GN=At2g36260 PE=3 SV=2) HSP 1 Score: 104.4 bits (259), Expect = 1.8e-21 Identity = 50/88 (56.82%), Postives = 61/88 (69.32%), Query Frame = 1
BLAST of MU61344 vs. Swiss-Prot
Match: ISCA1_DROME (Iron-sulfur cluster assembly 1 homolog, mitochondrial OS=Drosophila melanogaster GN=l(1)G0136 PE=1 SV=1) HSP 1 Score: 73.6 bits (179), Expect = 3.4e-12 Identity = 34/58 (58.62%), Postives = 41/58 (70.69%), Query Frame = 1
BLAST of MU61344 vs. Swiss-Prot
Match: ISA1_YEAST (Iron-sulfur assembly protein 1 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=ISA1 PE=1 SV=1) HSP 1 Score: 73.6 bits (179), Expect = 3.4e-12 Identity = 33/57 (57.89%), Postives = 42/57 (73.68%), Query Frame = 1
BLAST of MU61344 vs. Swiss-Prot
Match: Y484_RICPR (Uncharacterized protein RP484 OS=Rickettsia prowazekii (strain Madrid E) GN=RP484 PE=3 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 7.6e-12 Identity = 29/60 (48.33%), Postives = 45/60 (75.00%), Query Frame = 1
BLAST of MU61344 vs. TrEMBL
Match: A0A0A0KTF0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G614650 PE=4 SV=1) HSP 1 Score: 139.8 bits (351), Expect = 4.3e-30 Identity = 72/97 (74.23%), Postives = 75/97 (77.32%), Query Frame = 1
BLAST of MU61344 vs. TrEMBL
Match: A0A0A0KTF0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G614650 PE=4 SV=1) HSP 1 Score: 43.1 bits (100), Expect = 5.5e-01 Identity = 19/20 (95.00%), Postives = 19/20 (95.00%), Query Frame = 2
HSP 2 Score: 130.6 bits (327), Expect = 2.6e-27 Identity = 66/96 (68.75%), Postives = 73/96 (76.04%), Query Frame = 1
BLAST of MU61344 vs. TrEMBL
Match: F6HKK6_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_08s0007g03400 PE=4 SV=1) HSP 1 Score: 30.8 bits (68), Expect = 2.8e+03 Identity = 13/19 (68.42%), Postives = 14/19 (73.68%), Query Frame = 2
HSP 2 Score: 129.4 bits (324), Expect = 5.9e-27 Identity = 66/93 (70.97%), Postives = 69/93 (74.19%), Query Frame = 1
BLAST of MU61344 vs. TrEMBL
Match: V4U4F8_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10017146mg PE=4 SV=1) HSP 1 Score: 38.9 bits (89), Expect = 1.0e+01 Identity = 17/20 (85.00%), Postives = 18/20 (90.00%), Query Frame = 2
HSP 2 Score: 129.4 bits (324), Expect = 5.9e-27 Identity = 64/96 (66.67%), Postives = 73/96 (76.04%), Query Frame = 1
BLAST of MU61344 vs. TrEMBL
Match: W9QGG6_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_018365 PE=4 SV=1) HSP 1 Score: 39.7 bits (91), Expect = 6.1e+00 Identity = 20/24 (83.33%), Postives = 21/24 (87.50%), Query Frame = 2
HSP 2 Score: 129.4 bits (324), Expect = 5.9e-27 Identity = 66/93 (70.97%), Postives = 69/93 (74.19%), Query Frame = 1
BLAST of MU61344 vs. TAIR10
Match: AT2G16710.3 (AT2G16710.3 Iron-sulphur cluster biosynthesis family protein) HSP 1 Score: 119.0 bits (297), Expect = 4.0e-27 Identity = 61/99 (61.62%), Postives = 69/99 (69.70%), Query Frame = 1
HSP 2 Score: 33.1 bits (74), Expect = 2.9e-01 Identity = 13/19 (68.42%), Postives = 14/19 (73.68%), Query Frame = 2
BLAST of MU61344 vs. TAIR10
Match: AT2G36260.1 (AT2G36260.1 Iron-sulphur cluster biosynthesis family protein) HSP 1 Score: 104.4 bits (259), Expect = 1.0e-22 Identity = 50/88 (56.82%), Postives = 61/88 (69.32%), Query Frame = 1
BLAST of MU61344 vs. NCBI nr
Match: gi|659091836|ref|XP_008446757.1| (PREDICTED: iron-sulfur assembly protein IscA-like 1, mitochondrial [Cucumis melo]) HSP 1 Score: 144.1 bits (362), Expect = 3.3e-31 Identity = 74/97 (76.29%), Postives = 76/97 (78.35%), Query Frame = 1
BLAST of MU61344 vs. NCBI nr
Match: gi|449434502|ref|XP_004135035.1| (PREDICTED: iron-sulfur assembly protein IscA-like 1, mitochondrial [Cucumis sativus]) HSP 1 Score: 141.0 bits (354), Expect = 2.8e-30 Identity = 72/97 (74.23%), Postives = 75/97 (77.32%), Query Frame = 1
BLAST of MU61344 vs. NCBI nr
Match: gi|743851346|ref|XP_010940112.1| (PREDICTED: iron-sulfur assembly protein IscA-like 3, mitochondrial isoform X2 [Elaeis guineensis]) HSP 1 Score: 133.3 bits (334), Expect = 5.8e-28 Identity = 69/115 (60.00%), Postives = 78/115 (67.83%), Query Frame = 1
BLAST of MU61344 vs. NCBI nr
Match: gi|297740107|emb|CBI30289.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 131.7 bits (330), Expect = 1.7e-27 Identity = 66/96 (68.75%), Postives = 73/96 (76.04%), Query Frame = 1
BLAST of MU61344 vs. NCBI nr
Match: gi|731400858|ref|XP_002282752.2| (PREDICTED: iron-sulfur assembly protein IscA-like 1, mitochondrial [Vitis vinifera]) HSP 1 Score: 131.7 bits (330), Expect = 1.7e-27 Identity = 66/96 (68.75%), Postives = 73/96 (76.04%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|