MU61199 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
GCACTAATCCCGATCCCCACAAAATGGCCACCGCCTTCGCTACCTCCTCTGTCGCCGGCCTCGGAACCGCCTCCCTCTCCTCTCCTTCCTCCAGATCTCCCCGTCTAGTCTCCGGGTTCATCAAGTCGCCCGTGGCCGCCAGGAATCCGCTTAACGTAGGGCGTGCATCCCGTGGAAGGTTCACCTGGTTTGAGAGGGATTGGTGATCGAAATAGCAGAATGATTGGGTGTTTGGAGTGATCTGGGGGATT
BLAST of MU61199 vs. TrEMBL
Match: A0A0A0LT61_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G168350 PE=4 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 1.8e-12 Identity = 45/73 (61.64%), Postives = 49/73 (67.12%), Query Frame = 3
BLAST of MU61199 vs. TrEMBL
Match: A0A059DA19_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_B03824 PE=4 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 9.7e-06 Identity = 31/60 (51.67%), Postives = 38/60 (63.33%), Query Frame = 3
BLAST of MU61199 vs. TrEMBL
Match: A0A059D9C9_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_B03824 PE=4 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 9.7e-06 Identity = 31/60 (51.67%), Postives = 38/60 (63.33%), Query Frame = 3
BLAST of MU61199 vs. NCBI nr
Match: gi|659127336|ref|XP_008463649.1| (PREDICTED: uncharacterized protein LOC103501744 [Cucumis melo]) HSP 1 Score: 94.7 bits (234), Expect = 7.9e-17 Identity = 51/73 (69.86%), Postives = 53/73 (72.60%), Query Frame = 3
BLAST of MU61199 vs. NCBI nr
Match: gi|449443468|ref|XP_004139499.1| (PREDICTED: photosystem I subunit O [Cucumis sativus]) HSP 1 Score: 82.0 bits (201), Expect = 5.3e-13 Identity = 45/73 (61.64%), Postives = 49/73 (67.12%), Query Frame = 3
BLAST of MU61199 vs. NCBI nr
Match: gi|747083156|ref|XP_011088934.1| (PREDICTED: photosystem I subunit O [Sesamum indicum]) HSP 1 Score: 66.6 bits (161), Expect = 2.3e-08 Identity = 35/72 (48.61%), Postives = 42/72 (58.33%), Query Frame = 3
BLAST of MU61199 vs. NCBI nr
Match: gi|902196626|gb|KNA13155.1| (hypothetical protein SOVF_119330 [Spinacia oleracea]) HSP 1 Score: 58.5 bits (140), Expect = 6.3e-06 Identity = 34/68 (50.00%), Postives = 40/68 (58.82%), Query Frame = 3
BLAST of MU61199 vs. NCBI nr
Match: gi|697110292|ref|XP_009609016.1| (PREDICTED: photosystem I subunit O-like [Nicotiana tomentosiformis]) HSP 1 Score: 58.5 bits (140), Expect = 6.3e-06 Identity = 33/73 (45.21%), Postives = 40/73 (54.79%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|