MU45005 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
ACTCAATATCAAAATCGGTCTTCCGTCGTTGAATCCTCAAAGAAATCGGAACCGAACGACAGAAATGATTATACCTCCGATTGAATCAAGCAGGGAATTCGCTTCACTTTAATCTGCACCATCAGTGTTATCCTCTTCATTTTCATCATTAAGGAAAGAGAAATCGCGATGGTCTTCTCCCATGATTTACGTGAATTTATTCTTCGAGCAAGAGTGTTGAAACTGTATAGACAGGGTTTAAGAACAGCTCGGAAAGCACCTGTTGATGGTCGAGATGAATTGAGGCATATGATGAGAGAAGAAATGGAGAAGAACAGAAAGTGTAATGATAGACAGAAAATAAGATTTTTGTTGAGCGAAGGAATAGAGAGATTGAAGCAATTAGATGAGATGTTGGATATGCAAGGCCATTAACTAGAGATCTTTCTTTTCTTTCTTTTTTTTTATTAATTTTGATTATTGGGAGTTAAGTTTTTCTCCAATCATTTTGGAGTGTCTCATAGAAAGGAATGTTGTTTTAGGGGAAGGATATGAGTTTGGTTAAGGGCTTATCTTCAAGTTATTGTAATCAAATTGTGATTA
BLAST of MU45005 vs. Swiss-Prot
Match: LYRM2_PONAB (LYR motif-containing protein 2 OS=Pongo abelii GN=LYRM2 PE=3 SV=1) HSP 1 Score: 52.0 bits (123), Expect = 8.6e-06 Identity = 26/71 (36.62%), Postives = 44/71 (61.97%), Query Frame = 1
BLAST of MU45005 vs. TrEMBL
Match: A0A0A0LGK2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G874410 PE=3 SV=1) HSP 1 Score: 128.3 bits (321), Expect = 1.0e-26 Identity = 67/81 (82.72%), Postives = 68/81 (83.95%), Query Frame = 1
BLAST of MU45005 vs. TrEMBL
Match: W9RMC8_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_014312 PE=3 SV=1) HSP 1 Score: 120.6 bits (301), Expect = 2.2e-24 Identity = 58/81 (71.60%), Postives = 66/81 (81.48%), Query Frame = 1
BLAST of MU45005 vs. TrEMBL
Match: A9P9V6_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0014s17970g PE=2 SV=1) HSP 1 Score: 120.2 bits (300), Expect = 2.9e-24 Identity = 57/81 (70.37%), Postives = 69/81 (85.19%), Query Frame = 1
BLAST of MU45005 vs. TrEMBL
Match: M5XJM7_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa024578mg PE=3 SV=1) HSP 1 Score: 119.4 bits (298), Expect = 4.9e-24 Identity = 56/81 (69.14%), Postives = 68/81 (83.95%), Query Frame = 1
BLAST of MU45005 vs. TrEMBL
Match: M0SXN4_MUSAM (Uncharacterized protein OS=Musa acuminata subsp. malaccensis PE=3 SV=1) HSP 1 Score: 117.5 bits (293), Expect = 1.8e-23 Identity = 58/81 (71.60%), Postives = 68/81 (83.95%), Query Frame = 1
BLAST of MU45005 vs. TAIR10
Match: AT1G76065.1 (AT1G76065.1 LYR family of Fe/S cluster biogenesis protein) HSP 1 Score: 114.0 bits (284), Expect = 1.0e-25 Identity = 54/76 (71.05%), Postives = 63/76 (82.89%), Query Frame = 1
BLAST of MU45005 vs. NCBI nr
Match: gi|449437174|ref|XP_004136367.1| (PREDICTED: LYR motif-containing protein 2 [Cucumis sativus]) HSP 1 Score: 157.1 bits (396), Expect = 3.0e-35 Identity = 80/81 (98.77%), Postives = 81/81 (100.00%), Query Frame = 1
BLAST of MU45005 vs. NCBI nr
Match: gi|659132917|ref|XP_008466455.1| (PREDICTED: uncharacterized protein LOC103503854 [Cucumis melo]) HSP 1 Score: 156.4 bits (394), Expect = 5.2e-35 Identity = 80/81 (98.77%), Postives = 80/81 (98.77%), Query Frame = 1
BLAST of MU45005 vs. NCBI nr
Match: gi|700204931|gb|KGN60064.1| (hypothetical protein Csa_3G874410 [Cucumis sativus]) HSP 1 Score: 122.9 bits (307), Expect = 6.3e-25 Identity = 67/81 (82.72%), Postives = 68/81 (83.95%), Query Frame = 1
BLAST of MU45005 vs. NCBI nr
Match: gi|645228886|ref|XP_008221204.1| (PREDICTED: uncharacterized protein LOC103321195 [Prunus mume]) HSP 1 Score: 114.8 bits (286), Expect = 1.7e-22 Identity = 57/81 (70.37%), Postives = 68/81 (83.95%), Query Frame = 1
BLAST of MU45005 vs. NCBI nr
Match: gi|703112453|ref|XP_010100121.1| (hypothetical protein L484_014312 [Morus notabilis]) HSP 1 Score: 114.8 bits (286), Expect = 1.7e-22 Identity = 58/81 (71.60%), Postives = 66/81 (81.48%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|