MU44133 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
ATCGCCACCCATAGCAGCCTCCTTTTTTTCTCTATATTTCTCTCATTCTCTTTCTCCATGGACATCCAAGCGAAGCTTCTCCAACACAAAGACCAAATACCTGTTGTAGCAGCAGTTTCAGTTGTTCTGTCATTGTTTGTATATGTAGCCCCTCGGTTTCTAAGTATTCTAGCTTTCTTTTGGCCTCTCTTTGCCTCCACAGCTGTGCTCTTGGTGGTAATGACCGCCTTTGGAGGTGGTTTCCAAGTCGGAAGCGAGATTCATGGTATGAGAGCTGGTGAAGGAATTCTAGATTATGTTGCAGGACGACCTGAAAATGGCGAAAACCACTATAAGTACCAATAAAGAGATTATTTGTCACAATCAAATTTAAACAACATATATTCAAAATTTCTGTCTGTTCATTTTGTATATTTAAACTACCAATGAGTTAGTTCAGTGAAATAACCACATGGATGCTCAATGCA
BLAST of MU44133 vs. TrEMBL
Match: A0A0A0LYI8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G173160 PE=4 SV=1) HSP 1 Score: 148.7 bits (374), Expect = 6.0e-33 Identity = 73/95 (76.84%), Postives = 76/95 (80.00%), Query Frame = 1
BLAST of MU44133 vs. TrEMBL
Match: A0A061GGG1_THECC (Uncharacterized protein OS=Theobroma cacao GN=TCM_030419 PE=4 SV=1) HSP 1 Score: 94.4 bits (233), Expect = 1.3e-16 Identity = 44/95 (46.32%), Postives = 60/95 (63.16%), Query Frame = 1
BLAST of MU44133 vs. TrEMBL
Match: D7T5G5_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_00s0194g00220 PE=4 SV=1) HSP 1 Score: 85.9 bits (211), Expect = 4.8e-14 Identity = 44/86 (51.16%), Postives = 54/86 (62.79%), Query Frame = 1
BLAST of MU44133 vs. TrEMBL
Match: A0A151T6F9_CAJCA (Uncharacterized protein OS=Cajanus cajan GN=KK1_017189 PE=4 SV=1) HSP 1 Score: 85.9 bits (211), Expect = 4.8e-14 Identity = 45/87 (51.72%), Postives = 54/87 (62.07%), Query Frame = 1
BLAST of MU44133 vs. TrEMBL
Match: I1L024_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_09G013000 PE=4 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 1.8e-13 Identity = 43/86 (50.00%), Postives = 54/86 (62.79%), Query Frame = 1
BLAST of MU44133 vs. TAIR10
Match: AT4G16400.1 (AT4G16400.1 unknown protein) HSP 1 Score: 69.3 bits (168), Expect = 2.3e-12 Identity = 37/91 (40.66%), Postives = 48/91 (52.75%), Query Frame = 1
BLAST of MU44133 vs. TAIR10
Match: AT3G13175.1 (AT3G13175.1 unknown protein) HSP 1 Score: 48.9 bits (115), Expect = 3.3e-06 Identity = 34/91 (37.36%), Postives = 43/91 (47.25%), Query Frame = 1
BLAST of MU44133 vs. NCBI nr
Match: gi|659128598|ref|XP_008464280.1| (PREDICTED: uncharacterized protein LOC103502206 [Cucumis melo]) HSP 1 Score: 152.1 bits (383), Expect = 7.8e-34 Identity = 78/95 (82.11%), Postives = 78/95 (82.11%), Query Frame = 1
BLAST of MU44133 vs. NCBI nr
Match: gi|700209900|gb|KGN64996.1| (hypothetical protein Csa_1G173160 [Cucumis sativus]) HSP 1 Score: 145.2 bits (365), Expect = 9.5e-32 Identity = 73/95 (76.84%), Postives = 76/95 (80.00%), Query Frame = 1
BLAST of MU44133 vs. NCBI nr
Match: gi|590627047|ref|XP_007026343.1| (Uncharacterized protein TCM_030419 [Theobroma cacao]) HSP 1 Score: 90.9 bits (224), Expect = 2.1e-15 Identity = 44/95 (46.32%), Postives = 60/95 (63.16%), Query Frame = 1
BLAST of MU44133 vs. NCBI nr
Match: gi|702351137|ref|XP_010057807.1| (PREDICTED: uncharacterized protein LOC104445603 [Eucalyptus grandis]) HSP 1 Score: 83.6 bits (205), Expect = 3.4e-13 Identity = 44/84 (52.38%), Postives = 56/84 (66.67%), Query Frame = 1
BLAST of MU44133 vs. NCBI nr
Match: gi|297736712|emb|CBI25748.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 83.6 bits (205), Expect = 3.4e-13 Identity = 44/86 (51.16%), Postives = 54/86 (62.79%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|